ID: 1177209055

View in Genome Browser
Species Human (GRCh38)
Location 21:18047169-18047191
Sequence CATAATAATTAAATGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 699
Summary {0: 1, 1: 0, 2: 6, 3: 63, 4: 629}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177209055_1177209059 21 Left 1177209055 21:18047169-18047191 CCCTTCTCCATTTAATTATTATG 0: 1
1: 0
2: 6
3: 63
4: 629
Right 1177209059 21:18047213-18047235 ATATATTTTTTCCCTAACAAAGG 0: 1
1: 0
2: 4
3: 52
4: 461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177209055 Original CRISPR CATAATAATTAAATGGAGAA GGG (reversed) Intronic
902290951 1:15434375-15434397 AATATTTTTTAAATGGAGAAAGG + Intergenic
902648568 1:17821519-17821541 AAAAATAATTAAATGGAGAAAGG - Intronic
903087954 1:20881207-20881229 CAAAACATTTCAATGGAGAAAGG + Intronic
903520702 1:23946033-23946055 CAAAATCATTCAATGGAGAAAGG - Intergenic
904533582 1:31184377-31184399 CACATTTGTTAAATGGAGAAGGG + Intronic
904776649 1:32912752-32912774 CAGGATAATTTAATAGAGAATGG - Intergenic
905332996 1:37220684-37220706 AATAATAAGGAAATGTAGAAAGG + Intergenic
905532354 1:38691345-38691367 CAGCATAATTCAATGGGGAAGGG + Intergenic
905963425 1:42065580-42065602 TATTAGAATTAAATGGAAAATGG + Intergenic
906256850 1:44356886-44356908 CATAATAAATAAATTGGGGAGGG + Intergenic
907568121 1:55456361-55456383 CATAAAAATTAACTGGAAATTGG + Intergenic
908325600 1:63020471-63020493 CATAATACTTAAACATAGAAAGG - Intergenic
908563320 1:65329036-65329058 GATAATAAATAAATAGTGAATGG + Intronic
908825683 1:68130853-68130875 AATAATAATAAAATGGTGAATGG + Intronic
909725964 1:78835415-78835437 CATAATAATTCATATGAGAAAGG - Intergenic
910151941 1:84158894-84158916 CAAGATAATTAAATAGAGAAAGG - Intronic
910316277 1:85887292-85887314 CAAAATAATAAAAGAGAGAATGG + Intronic
910417865 1:87020514-87020536 TAAAATAATTAAATTAAGAATGG - Intronic
910621088 1:89255548-89255570 CATAATGATCAGATGGAGAAGGG - Intergenic
910683124 1:89888309-89888331 AATAATAAGTAAATGGATAGTGG + Intronic
910942458 1:92551351-92551373 CATATCCATAAAATGGAGAAGGG - Intronic
910955350 1:92697281-92697303 TATAAAAATTAAATCCAGAAAGG + Intronic
911892169 1:103385290-103385312 CAAAAAAATGAAATGGGGAAAGG - Intergenic
911992981 1:104726230-104726252 CACAATTATAAAATGGACAAAGG + Intergenic
912022100 1:105118096-105118118 AATAATAAATAAGTGGGGAAAGG + Intergenic
912727805 1:112075173-112075195 GATAATAATTGAATGCATAAAGG + Intergenic
912918328 1:113840856-113840878 CAAGAAAATTCAATGGAGAAAGG + Intronic
913006558 1:114638461-114638483 CTTAAAAATTAAATGGAGCTGGG + Intronic
915006903 1:152646558-152646580 GGTAATAAATAAATAGAGAATGG - Intergenic
915862781 1:159464826-159464848 AATAACAATTTAGTGGAGAAAGG - Intergenic
915988825 1:160492609-160492631 CATATTCATTAAGTGGAAAAAGG - Intronic
916844401 1:168634297-168634319 CAAAGCAATTCAATGGAGAAAGG + Intergenic
917282690 1:173393980-173394002 AATAATAATTCAAAGGAAAATGG - Intergenic
917284322 1:173408459-173408481 CCAACTAATTAAATGCAGAATGG + Intergenic
917828093 1:178845301-178845323 ATTAAAAATTAAATGGGGAAGGG - Intronic
918205790 1:182308036-182308058 CAGAATAAATAAATACAGAAAGG - Intergenic
918457962 1:184744663-184744685 AATACTCATTAAATGGTGAATGG + Intronic
918806557 1:189054429-189054451 CATAACAATAGAAAGGAGAACGG - Intergenic
918817004 1:189199612-189199634 AATATTAAATAAATGTAGAAAGG + Intergenic
918941431 1:191003661-191003683 AAAAATAATCACATGGAGAATGG + Intergenic
919281971 1:195502002-195502024 GATAAGAATTGAATGGATAAAGG - Intergenic
919835425 1:201570033-201570055 CATAATAAATAAAATGAAAATGG - Intergenic
920220432 1:204395052-204395074 CAAAATTACTCAATGGAGAAAGG + Intergenic
920403427 1:205691789-205691811 CATAAGAGTAAAATGGAGATAGG - Intergenic
921668071 1:217896273-217896295 CATAATAATAAAATGCAGAGAGG - Intergenic
921694891 1:218197685-218197707 GAAAATATTTAAATGGAGAAAGG + Intergenic
922404662 1:225299387-225299409 AAAAATAACTCAATGGAGAAAGG - Intronic
922568044 1:226614576-226614598 CATATTAACTAAATGCAAAAGGG - Intergenic
923359495 1:233196116-233196138 CATGATAATTCAACGGAGAAAGG + Intronic
923370356 1:233305100-233305122 GATAATAATAACATGAAGAAAGG + Intergenic
923935022 1:238749674-238749696 TATAAAAACTCAATGGAGAATGG + Intergenic
924535200 1:244929721-244929743 GATGATATTTAAATGGAGACTGG - Intergenic
924655235 1:245968765-245968787 CAGAATTATTAAATGGAATATGG - Intronic
1063354933 10:5389144-5389166 GAAAATAAATCAATGGAGAAAGG + Intergenic
1063744622 10:8866473-8866495 AATAATAACTAAAAAGAGAATGG + Intergenic
1063951152 10:11224587-11224609 CATGATAATCAAATGATGAAAGG + Intronic
1064174584 10:13063334-13063356 CATAAAAATCAAATAGAGGATGG - Intronic
1064665417 10:17645548-17645570 CATATTATTTAACTGCAGAATGG - Intronic
1064809020 10:19173139-19173161 CATATTAAGTAAATAGAAAATGG - Intronic
1064844407 10:19635121-19635143 CAAAAGACTTAACTGGAGAATGG + Intronic
1064920016 10:20505777-20505799 CATAGAAATTAAAAGGAGGATGG + Intergenic
1065038130 10:21661605-21661627 AATAAAAAGGAAATGGAGAAAGG - Intronic
1065255722 10:23865840-23865862 CATTTTAATTTATTGGAGAAAGG - Intronic
1066474677 10:35734371-35734393 CAAGATAATTCAGTGGAGAAAGG - Intergenic
1066551779 10:36566696-36566718 CAAAATAAATAAATACAGAATGG - Intergenic
1067708599 10:48629476-48629498 CAAGGTAATTCAATGGAGAAAGG - Intronic
1068060191 10:52058654-52058676 CATAAAAATTAAATGAAAATTGG + Intronic
1068134892 10:52941588-52941610 CAAAAAAATTTAATGGAGAAAGG - Intergenic
1068308236 10:55243296-55243318 CATAAATATTAAATGCAGACAGG + Intronic
1068506194 10:57902317-57902339 AAAAGTAATTCAATGGAGAAAGG + Intergenic
1069212161 10:65775862-65775884 CAGAATAATAAAATAAAGAAAGG + Intergenic
1069878844 10:71579387-71579409 CAGAATAATGAAATGGGGGAGGG - Intronic
1070377867 10:75851757-75851779 CAAAATAATTAATAGGAGCATGG - Intronic
1070970056 10:80556193-80556215 CAAGATAATGCAATGGAGAAAGG - Intronic
1071226180 10:83531081-83531103 GAAAATAATTAAATAAAGAATGG + Intergenic
1071519862 10:86323107-86323129 CATAAAAATCAAAGGGAGAAAGG + Intronic
1072366048 10:94711029-94711051 ATTAATAATAAAATGGAGAGTGG - Intronic
1072473346 10:95734552-95734574 AAGAACAATTAAACGGAGAAGGG + Intronic
1072640185 10:97205756-97205778 CATAGTAAATTAATGCAGAAGGG - Intronic
1073613154 10:104964900-104964922 CATAATGACAAAATGTAGAATGG - Intronic
1073811340 10:107155594-107155616 TATAATCATTAAAGGGAAAAAGG - Intronic
1074583293 10:114741712-114741734 CAAAATAAGTATATGGATAAAGG + Intergenic
1076211453 10:128649297-128649319 CAAAATAATAAACTGGAGAAAGG + Intergenic
1076338193 10:129724661-129724683 AATAATAATAAAATGGATATGGG + Intronic
1077719477 11:4613288-4613310 CATAATACTTAAGGGAAGAATGG - Intergenic
1078633021 11:13021739-13021761 CAGATAAATGAAATGGAGAATGG - Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079242460 11:18730093-18730115 GATAGTAATAAATTGGAGAAGGG - Intronic
1079531989 11:21465250-21465272 AATAATATTTAAATTGGGAAAGG + Intronic
1080112990 11:28590168-28590190 CCTTATAATTGAATGGACAAGGG - Intergenic
1080256176 11:30292983-30293005 CAACATAATGAAATGGGGAAAGG + Intergenic
1080368516 11:31608091-31608113 TATGATAATGAGATGGAGAACGG + Intronic
1082690426 11:56296054-56296076 CATAATAACTCAATGGATAAAGG - Intergenic
1083071520 11:59988762-59988784 CATAATAATCACATGGAGAATGG + Intergenic
1083155421 11:60819990-60820012 CATAAGAGTGAAATGGAGATTGG + Intergenic
1085242809 11:75072615-75072637 CATAATTATTAACTAGGGAATGG + Intergenic
1085935207 11:81133485-81133507 TACAATATTTTAATGGAGAAGGG - Intergenic
1086036300 11:82418867-82418889 CAAAATAATTTCATGGCGAAGGG + Intergenic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1086502241 11:87465328-87465350 CAGGATAATAAAATTGAGAATGG + Intergenic
1086770515 11:90758919-90758941 AAAAGTAATTCAATGGAGAAAGG + Intergenic
1086882279 11:92162763-92162785 CATGAAAAATAAATGGAAAAAGG - Intergenic
1087491236 11:98829734-98829756 AATAGTAATTAAAAGGAAAATGG - Intergenic
1088147582 11:106700927-106700949 TATAATAATTATATTGACAAAGG + Intronic
1088211500 11:107461770-107461792 CAAAATCAAGAAATGGAGAAAGG - Intergenic
1088491230 11:110389829-110389851 CAAAGTAATTTAATGAAGAAAGG - Intergenic
1088643883 11:111900376-111900398 CATAATAATTGTATTTAGAAAGG - Intergenic
1089019183 11:115194636-115194658 GAAAATAATAAAATGGAGAGGGG + Intronic
1090743997 11:129692316-129692338 CATAATAAATAAAGAGATAAAGG - Intergenic
1091249914 11:134135274-134135296 CAACATCATTTAATGGAGAAAGG - Intronic
1091573132 12:1708629-1708651 CAAAGTAATTAAATGAGGAAAGG - Intronic
1091729981 12:2873539-2873561 AAAAATAAATAAATGAAGAAGGG - Intronic
1092201923 12:6590259-6590281 CACAATAACTAAATGGAACACGG + Intronic
1092494539 12:8979506-8979528 CATTATAATTAAATTGTTAAAGG - Intronic
1092498650 12:9023957-9023979 CAAAAGAATTCAATGGAAAAAGG - Intergenic
1093066420 12:14662980-14663002 CATATTAATTAAAATGAAAAAGG + Intronic
1093326388 12:17780322-17780344 CATAATCATGTTATGGAGAAAGG + Intergenic
1094361038 12:29631493-29631515 CAAAGTAATTCAATGGAGAAAGG - Intronic
1094555792 12:31498375-31498397 CAGAACAATTATATTGAGAATGG - Intronic
1094704442 12:32900390-32900412 GAGAAGAATTAAGTGGAGAAGGG - Intergenic
1094801241 12:34038308-34038330 GATATTATTTTAATGGAGAAAGG - Intergenic
1094869099 12:34578343-34578365 TATAATAATAAAAAAGAGAAAGG + Intergenic
1095114374 12:38334300-38334322 GATATTATTTTAATGGAGAAAGG - Intergenic
1095775753 12:46008018-46008040 CATGACAATTCAATGGGGAAAGG - Intergenic
1096026731 12:48371464-48371486 CAATATAATTGAATAGAGAAAGG + Intergenic
1096347056 12:50858311-50858333 CAAAATAATTGGAGGGAGAATGG - Intronic
1097124076 12:56759472-56759494 CATAATAAACAAAAGGAGAATGG + Intronic
1097403196 12:59154964-59154986 CATAATAATTTTATGCAAAACGG - Intergenic
1097683476 12:62670763-62670785 CATACAAATTACATGAAGAACGG - Intronic
1098034617 12:66289317-66289339 CATAATAAGTTAGGGGAGAAAGG + Intergenic
1098443451 12:70542269-70542291 CACAATATTTAAATGGGCAAAGG - Intronic
1098678710 12:73322674-73322696 CAGAATAGATAAATGAAGAAAGG + Intergenic
1098805785 12:75018944-75018966 CATATTAATTAAATTCAAAAGGG - Intergenic
1098820775 12:75225547-75225569 AATAATAATTGAATAGATAATGG + Intergenic
1099131335 12:78836001-78836023 CAAAATAAGCAAATAGAGAATGG + Intergenic
1099165527 12:79302371-79302393 GATGTTAATTAAATGGAGTAAGG + Intronic
1099339944 12:81417695-81417717 CATAAAAATAAAATGGAAATGGG - Intronic
1099448825 12:82784242-82784264 CAAAATAATTAACTGGGGTATGG - Intronic
1099482060 12:83180020-83180042 CATGTTAATTAAATAGAGTAAGG + Intergenic
1099716016 12:86295026-86295048 CATCACAATTACATGGAGAATGG + Intronic
1099718661 12:86332359-86332381 GAAAATAATAAAATGAAGAACGG + Intronic
1099739499 12:86614409-86614431 CAGAATAATTAAAGGGATTATGG + Intronic
1099910372 12:88825048-88825070 CATAGTAATTTAATGGGCAAAGG + Intergenic
1100127633 12:91448241-91448263 AATTATAAATAAATTGAGAAAGG + Intergenic
1100327874 12:93557042-93557064 CAAGGTAATTCAATGGAGAAAGG - Intergenic
1100346802 12:93739660-93739682 CATAATTTTGAAATGGGGAAAGG + Intronic
1101389327 12:104286183-104286205 CATAATAACTGAATGAAGGAAGG - Intronic
1101805428 12:108059482-108059504 GATAAAAATTAAATAGAGCAAGG - Intergenic
1102820061 12:115900957-115900979 CACAAAAATTAATTTGAGAAGGG - Intergenic
1103278177 12:119731591-119731613 CATGATACCTAAATGGGGAAAGG - Intronic
1104098624 12:125584861-125584883 CTTAATAATTTAAAGGAGGAAGG - Intronic
1104754208 12:131258703-131258725 ATGAATAAGTAAATGGAGAAGGG - Intergenic
1105012358 12:132764230-132764252 CTTAATAACTTAATGGAGAGTGG - Intergenic
1105828784 13:24145725-24145747 CATGATCAATAAATAGAGAACGG + Intronic
1106060497 13:26286394-26286416 CAAAAACATTAAATGGGGAAAGG + Intronic
1106238315 13:27885160-27885182 AAAAATAATTAAATGGAAAAAGG + Intergenic
1106622097 13:31380521-31380543 GATAATAATTAAAGAGACAAGGG + Intergenic
1106968289 13:35101526-35101548 CACAATTATTAAATGGGCAAAGG - Intronic
1107173492 13:37372348-37372370 TAAAGCAATTAAATGGAGAAAGG - Intergenic
1107571358 13:41661905-41661927 CACAACAGTTTAATGGAGAAAGG - Intronic
1107652460 13:42559111-42559133 TATAATAATGAAAAGAAGAATGG + Intergenic
1108335423 13:49436433-49436455 AATGAAAATTAAATGAAGAAAGG - Intronic
1108423459 13:50273903-50273925 CATAATAAATATATGCAGTAAGG - Intronic
1108544195 13:51474759-51474781 CATATTAATTAACTGGATAATGG - Intergenic
1108616850 13:52141665-52141687 CAGAATAATGAAATGGAACAGGG - Intronic
1109176461 13:59163319-59163341 CAAAGTAATTCAATGGAAAAAGG - Intergenic
1109558988 13:64022351-64022373 CATAAGAAATAAAGGAAGAAAGG - Intergenic
1109767627 13:66925851-66925873 CATAATAAATAAATGAAGCTCGG - Intronic
1109926338 13:69145079-69145101 GATATTAATTCAATGAAGAAAGG + Intergenic
1110037727 13:70709833-70709855 AATAATCATTAAATGAAGACAGG + Intergenic
1110570269 13:76995421-76995443 CATAATATTACAATGGATAATGG - Intronic
1110606818 13:77442564-77442586 CAAATTAATGAAATGGAGGAAGG - Intergenic
1110668509 13:78147054-78147076 CATAATAACTATTTGAAGAATGG - Intergenic
1110771544 13:79354194-79354216 CATAAATATTAACTGGAGAGAGG + Intronic
1111092755 13:83468336-83468358 CAAAATAAATATATGGAGACAGG + Intergenic
1111309473 13:86463730-86463752 CAAAACAATTCAATAGAGAAAGG + Intergenic
1111423165 13:88044229-88044251 GATAATAATTAAGTAGACAATGG + Intergenic
1111863456 13:93738570-93738592 CATGAGGATTAAATGCAGAATGG - Intronic
1111919096 13:94392054-94392076 CATAATAACCAAAAGGTGAAAGG - Intronic
1112088641 13:96057647-96057669 CATAAAAATTGAAAGTAGAATGG - Intergenic
1112509061 13:99992117-99992139 AATAAGGATTAACTGGAGAAAGG - Intergenic
1112540820 13:100310923-100310945 CATAATTATTAAATGGCGTCAGG - Intronic
1112747709 13:102545901-102545923 CAAAATCATAAAGTGGAGAAAGG + Intergenic
1112810609 13:103214236-103214258 CTTAATAATTAAATGTAAAATGG + Intergenic
1115175939 14:30561700-30561722 CATAAAAATTAAAAGGACAAGGG - Intronic
1115184665 14:30672223-30672245 CATTATAATTAGATGGAACAAGG + Intronic
1115300533 14:31880270-31880292 CATAATAATTGTATGGGGATGGG - Intergenic
1115526398 14:34284655-34284677 CTTAATAAGTAATGGGAGAAAGG + Intronic
1115687720 14:35813450-35813472 TATAATAAGTAAAGGGAGAAGGG - Intergenic
1116108777 14:40547857-40547879 CTTAATAAATAATTCGAGAATGG + Intergenic
1116381857 14:44278773-44278795 CAAAATAAGTAAATGGAGGCTGG - Intergenic
1116392537 14:44410482-44410504 GAGAATAATTGAATGAAGAATGG - Intergenic
1116779387 14:49219321-49219343 CATAAACATGATATGGAGAAAGG - Intergenic
1118089686 14:62459829-62459851 CAAAACAATTCAATGGAAAAAGG - Intergenic
1118298549 14:64593288-64593310 CACAATATTTAAATGGGCAAAGG + Intergenic
1118733638 14:68686794-68686816 CATAAAGATGAAAAGGAGAATGG - Intronic
1118998456 14:70859045-70859067 AATAAAAATGAAATGGAGAATGG + Intergenic
1119013071 14:71017288-71017310 CAGATGAATGAAATGGAGAAAGG + Intronic
1119801264 14:77447500-77447522 CAGGATAATTCAATGGGGAAAGG + Intronic
1120118237 14:80645443-80645465 GATAATTATTATATGGAGTAGGG + Intronic
1120600648 14:86502111-86502133 AAAAATAATTCACTGGAGAAAGG + Intergenic
1120686790 14:87547299-87547321 CATAATAATTCAAAGTAGAGTGG - Intergenic
1121398566 14:93650940-93650962 CATAAAAATTAATTTGAGATGGG - Intronic
1122617940 14:103033709-103033731 AATAATATTTAAATAGAGGATGG + Intronic
1122911948 14:104834427-104834449 CAAAAGAATTAAATGGAGGCTGG - Intergenic
1123203384 14:106690031-106690053 CACATTAATTAAATGGACAATGG + Intergenic
1123792423 15:23735372-23735394 TATAATAATTAATTGAATAATGG - Intergenic
1124018192 15:25896339-25896361 CATAACACTTCAAAGGAGAAAGG - Intergenic
1124146429 15:27130308-27130330 CAAGACCATTAAATGGAGAATGG - Intronic
1124602965 15:31150049-31150071 CCTAAGGATGAAATGGAGAATGG - Intronic
1125165484 15:36699597-36699619 CATAATTCTTAAATTAAGAAGGG - Intronic
1125997827 15:44181341-44181363 CATAATAAAAAAATGTAAAAAGG - Intronic
1126282339 15:46968802-46968824 CAAAATAATGGGATGGAGAAAGG + Intergenic
1127097915 15:55532389-55532411 CAAGATAATTCAATGGAGAAAGG - Intergenic
1127667514 15:61163237-61163259 CATAGAAATTAAATGGACAAGGG + Intronic
1127727916 15:61768522-61768544 CATCATCATTATATGGAGGAAGG - Intergenic
1127804277 15:62504557-62504579 CACTGTAATTCAATGGAGAATGG + Intronic
1128316812 15:66665216-66665238 CAAGATAATTCAATGGGGAAAGG - Intronic
1129085996 15:73092971-73092993 CATAACAATTAAATGTAATATGG - Intronic
1129565362 15:76616426-76616448 CATAATAATAGAAAGTAGAATGG + Intronic
1131173537 15:90195385-90195407 CATAATAATCAAATGCAGCGAGG - Intronic
1131561398 15:93445670-93445692 CAAGATAATTTAATGGAGAAAGG + Intergenic
1132122308 15:99187190-99187212 CAAAATAATTTGATGGTGAAAGG + Intronic
1135077446 16:19406169-19406191 CATATTAATTAAATTCAAAAGGG - Intergenic
1136071376 16:27789559-27789581 CATAATGGTTGAATGGATAAGGG + Exonic
1136518393 16:30781635-30781657 CAAAAAAATTACATGGGGAAGGG - Exonic
1136923686 16:34351492-34351514 CATAATGAATAAAAGGAAAATGG - Intergenic
1136980887 16:35060314-35060336 CATAATGAATAAAAGGAAAATGG + Intergenic
1137445408 16:48528647-48528669 GATGACAATTCAATGGAGAACGG - Intergenic
1137652907 16:50135668-50135690 CATAATGATTACATGGGGAATGG + Intergenic
1137865355 16:51889896-51889918 GATAATAATTTAATGGAGAAAGG + Intergenic
1138005640 16:53333980-53334002 AACAGTAATTAAATAGAGAATGG + Intergenic
1138825765 16:60317881-60317903 CATAGTAATCTAATGGAAAATGG + Intergenic
1139362740 16:66411889-66411911 AAAAATAATTCAATGGAGAAAGG + Intergenic
1203143668 16_KI270728v1_random:1785459-1785481 AATAACAATTAAATGGAAACAGG + Intergenic
1143040417 17:4031463-4031485 CAAGATAATTGGATGGAGAAAGG + Intronic
1143313245 17:6010996-6011018 AATAATAAATAAATGGATAGGGG - Intronic
1144562849 17:16336019-16336041 CATTTTAAATAAATGAAGAATGG + Intronic
1145753829 17:27375335-27375357 CAAAGCAATTCAATGGAGAAGGG - Intergenic
1145823370 17:27857752-27857774 TATAATATTTAAAAGGAAAATGG - Intronic
1146476815 17:33169373-33169395 CAAAACAATAAAATGGGGAAAGG + Intronic
1147279583 17:39347951-39347973 CAAAATCAAGAAATGGAGAAAGG - Intronic
1147502127 17:40975812-40975834 TGTAATAATCACATGGAGAATGG - Intergenic
1148324516 17:46775473-46775495 CAAAATAAACAAATGGAAAAAGG - Intronic
1149162567 17:53711760-53711782 CTAAATTATTAAATGAAGAAGGG + Intergenic
1149186611 17:54005204-54005226 CATATTAGTCAAATGAAGAAAGG - Intergenic
1149643758 17:58223205-58223227 CAAGGTAATTCAATGGAGAAAGG + Intronic
1150057679 17:62033893-62033915 CAAAAAAATTAATTGGTGAATGG - Exonic
1151498040 17:74471155-74471177 CTTAATAAGTAAATGGAGCCTGG - Intronic
1152187382 17:78866376-78866398 AAAAAAAATCAAATGGAGAAGGG - Intronic
1152547209 17:81006892-81006914 CAAAACAATTACACGGAGAAAGG - Intronic
1153395612 18:4617098-4617120 CAAAATCATGAAATGGGGAAAGG - Intergenic
1154931900 18:21007185-21007207 AAAAATGACTAAATGGAGAAAGG - Intronic
1154932193 18:21011439-21011461 GATAAAAATTAAAAGAAGAAAGG - Intronic
1154943257 18:21135808-21135830 CAAAGAAATTAAATGGTGAAAGG - Intergenic
1155282884 18:24258665-24258687 CGTAATAATCACATGGAAAATGG - Intronic
1155753297 18:29456510-29456532 CATAATAAGTAAATTGTTAAAGG + Intergenic
1155899266 18:31367882-31367904 AAAAATAATCAAATGGGGAAAGG + Intergenic
1156198544 18:34804065-34804087 CATAATAAGTAAAAAGTGAAGGG + Intronic
1156307650 18:35893643-35893665 AAAAACAATTCAATGGAGAAAGG + Intergenic
1156333194 18:36145060-36145082 CATAAGATTTAACTGGAGTAAGG - Intronic
1156399881 18:36730576-36730598 TTTAATAATGAAATGCAGAAAGG + Intronic
1156652842 18:39246593-39246615 AATAGTAATTCAATGGAGAAAGG + Intergenic
1156665230 18:39396786-39396808 AAAGGTAATTAAATGGAGAAAGG + Intergenic
1156935297 18:42698376-42698398 AAAAATGAATAAATGGAGAAGGG - Intergenic
1156945904 18:42831359-42831381 CAAATTAATTTTATGGAGAATGG - Intronic
1156981640 18:43296124-43296146 AAAAGCAATTAAATGGAGAAAGG - Intergenic
1157104717 18:44763124-44763146 CCTAAAAATTAAATAGAGATAGG + Intronic
1158828225 18:61248446-61248468 CAACACAATTAAAGGGAGAATGG + Intergenic
1158990882 18:62867224-62867246 CATAATATTTAGAAAGAGAAAGG - Intronic
1159393614 18:67828166-67828188 CATAAAAAGTCAATGTAGAAGGG - Intergenic
1159531708 18:69663517-69663539 GATAATAATTAAATGGTCCATGG + Intronic
1159671742 18:71228478-71228500 CTTCTTAATTAAATAGAGAAGGG + Intergenic
1159718210 18:71851297-71851319 CAGAAAAATAAAATGGAGATGGG - Intergenic
1159730345 18:72018731-72018753 AATAATAAGTAAATGTAGAAAGG + Intergenic
1162669249 19:12240681-12240703 CATGATCATTCAATGGAGAAAGG + Intronic
1164845425 19:31428546-31428568 CATAATTATTTTATGCAGAAGGG - Intergenic
1166167979 19:41005794-41005816 AATAATAATAAAATAAAGAACGG + Intronic
1166414565 19:42584853-42584875 GATATAAATGAAATGGAGAATGG + Intronic
1166430796 19:42725419-42725441 GATATAAATAAAATGGAGAATGG + Intronic
1166443818 19:42840768-42840790 GATATAAATAAAATGGAGAATGG + Intronic
1166451260 19:42903450-42903472 GATATAAATAAAATGGAGAATGG + Intronic
1166463501 19:43011447-43011469 GATATAAATAAAATGGAGAATGG + Intronic
1167846107 19:52165848-52165870 CAAATTAATGAAATGGAAAATGG - Intronic
1168454144 19:56492439-56492461 CATAATACTTAAATGTATGAAGG + Intergenic
1168511315 19:56975697-56975719 CATGAGAATTAAATGAACAAGGG + Intergenic
926382196 2:12301860-12301882 CAAAATAGATAAATGAAGAAGGG + Intergenic
926449548 2:12985551-12985573 CATTATAGTAAAATGGAAAAAGG - Intergenic
926701870 2:15809415-15809437 GATGAAAATTAAATGGGGAAGGG + Intergenic
926804385 2:16692242-16692264 CTGAATAATAAAATGAAGAAAGG + Intergenic
926956577 2:18308183-18308205 CATAATAACTAAATGCAACATGG - Intronic
927163214 2:20289830-20289852 CATTATGATTAAATGGAAATTGG + Intronic
927411932 2:22836411-22836433 CACTATAATAAAATGGAGAATGG + Intergenic
928580586 2:32703654-32703676 CATTAGCATTAAATGAAGAACGG - Intronic
929214715 2:39399873-39399895 CATAATATTTATATGGGGGAGGG + Intronic
929380240 2:41341597-41341619 CAAAAAAATTAAATAAAGAATGG + Intergenic
929616194 2:43310472-43310494 CATGACAATTCAATGGGGAAAGG + Intronic
930546582 2:52774717-52774739 AATCAAAATTAAATGAAGAAGGG + Intergenic
930688332 2:54332275-54332297 GACAATAATAAAATAGAGAATGG - Intronic
930832598 2:55761105-55761127 AATAAATATAAAATGGAGAAGGG - Intergenic
931023755 2:58083457-58083479 AATAAGAATTAAATGAAGTAAGG + Intronic
931764847 2:65445915-65445937 CATAATAATCACATGGAAAGTGG + Intergenic
932010608 2:67973973-67973995 CATAATCATATCATGGAGAATGG + Intergenic
932196916 2:69792550-69792572 CATATTAACTAAATGCAAAAGGG - Intronic
932209680 2:69915992-69916014 GGAAATAATTAAATGGAGTAAGG - Intronic
932537492 2:72615047-72615069 CAAAATATTTAAATGGGGGAGGG + Intronic
932642099 2:73459535-73459557 ATAAATAAATAAATGGAGAAGGG - Intronic
933032318 2:77345243-77345265 CACAATAATTAAAAAGAAAAAGG + Intronic
933580814 2:84124791-84124813 CATAATAATAAAAAGCACAATGG + Intergenic
934021152 2:87954250-87954272 CGTATAAAATAAATGGAGAAAGG - Intergenic
934152704 2:89163657-89163679 CACAATAATTAAATGCAGTGTGG - Intergenic
934163874 2:89276518-89276540 CAAAATTATTAAAGTGAGAAAGG - Intergenic
934203398 2:89906006-89906028 CAAAATTATTAAAGTGAGAAAGG + Intergenic
934214537 2:90018277-90018299 CACAATAATTAAATGCAGTGTGG + Intergenic
935826189 2:106952542-106952564 AATAATAATTTCATGGAGGATGG - Intergenic
935916443 2:107956821-107956843 CATTATAAGTCAATGGGGAAAGG + Intergenic
936248626 2:110849992-110850014 CAAAATGATTCAGTGGAGAAAGG + Intronic
939068262 2:137509370-137509392 CAAAATAAATAAAGGAAGAAAGG - Intronic
939124655 2:138163064-138163086 TATAATAATTAAGTGGAAGATGG + Intergenic
939152393 2:138488334-138488356 CTGAATAAATAACTGGAGAATGG + Intergenic
939198160 2:138999070-138999092 GAAGATAATTAACTGGAGAAGGG + Intergenic
939648083 2:144726485-144726507 CAAGATAATGCAATGGAGAAAGG + Intergenic
940187208 2:150999236-150999258 TGTAATAAATTAATGGAGAAAGG + Intergenic
940229829 2:151439135-151439157 CATAATCATTAAGTGGAAACGGG + Intronic
940843874 2:158618460-158618482 CATAATATTTAAAAGGAATATGG + Intronic
941117996 2:161493751-161493773 AAGAATAATAAATTGGAGAAGGG + Intronic
942282528 2:174380404-174380426 CATAATAACTAAATGGTGTTTGG - Intronic
944626460 2:201574311-201574333 GATGATATTTTAATGGAGAAGGG + Intronic
944965865 2:204932511-204932533 AATAACAATCATATGGAGAAAGG - Intronic
945659077 2:212662014-212662036 GATAATAATAAGAGGGAGAAGGG + Intergenic
946521767 2:220473121-220473143 CATAATATTAAGATTGAGAAAGG - Intergenic
947011146 2:225568380-225568402 CAAAATAAATAAAAGGAGAGTGG - Intronic
948022952 2:234752000-234752022 GATAATAATTAAATGCAGGTAGG - Intergenic
1169835131 20:9869469-9869491 TATTATCATTAAAGGGAGAAGGG + Intergenic
1170087445 20:12550276-12550298 CATGATAATTAAGTGGAGCTTGG + Intergenic
1170149266 20:13212012-13212034 CATACTAATGAAATGGAGTGGGG + Intergenic
1170287481 20:14726008-14726030 TATAATATTTCAATGAAGAAAGG - Intronic
1170868838 20:20185965-20185987 CAAAATAATTGAAAGGAAAAGGG - Intronic
1171319659 20:24230840-24230862 CACAACTATTCAATGGAGAAAGG + Intergenic
1171430222 20:25078634-25078656 AATAATAATAAAATGAAAAAAGG + Intronic
1173405483 20:42760839-42760861 ATTAATAATAGAATGGAGAAAGG - Intronic
1174935914 20:54868411-54868433 CATGATAATTAAATGCAGTGTGG - Intergenic
1175090611 20:56500497-56500519 TATAATAATTAAATGAAGAGAGG + Intronic
1175287679 20:57848392-57848414 CAAAATATTGACATGGAGAATGG - Intergenic
1176890158 21:14306489-14306511 GAAAATAATTGAATGGAGGATGG - Intergenic
1177085503 21:16697661-16697683 CAAAATAATGCCATGGAGAAAGG - Intergenic
1177209055 21:18047169-18047191 CATAATAATTAAATGGAGAAGGG - Intronic
1177223524 21:18223700-18223722 CATAATTAAAAAAAGGAGAAAGG + Intronic
1177246044 21:18525351-18525373 CTTAAAAATTAAAAGGATAAAGG + Intergenic
1177522410 21:22243932-22243954 CATAATAATTATCTGCAGGAGGG - Intergenic
1177616549 21:23529189-23529211 CAAAAATATTCAATGGAGAAAGG + Intergenic
1177927919 21:27242070-27242092 AAAATTTATTAAATGGAGAAGGG - Intergenic
1178392583 21:32211344-32211366 CAGGATTATTAATTGGAGAAAGG + Intergenic
1178414976 21:32397079-32397101 AAAAATAAGTAAATGGATAAAGG + Intergenic
1178729607 21:35088177-35088199 CACAAAAATTAAATGTAGATGGG + Intronic
1178897781 21:36574283-36574305 CAAAGTAATTCAATGGAGAAAGG + Intronic
1179094607 21:38301351-38301373 AATAATAATGAAATGAAGAGAGG - Exonic
1179327020 21:40357293-40357315 CTGAATAATTAAGTGGAGACAGG + Intronic
1183767217 22:39889381-39889403 CAAAATAATGAAAAAGAGAAAGG - Intronic
1184316412 22:43695707-43695729 CAAAGTAATTCATTGGAGAAGGG + Intronic
1184818795 22:46893170-46893192 CATAAAAATCAAATGAAGAAAGG - Intronic
1185307838 22:50131689-50131711 AATAGTAATTCATTGGAGAAAGG - Intronic
949272520 3:2235998-2236020 CATCTTAATTCAATGGAGAAGGG + Intronic
949289573 3:2448688-2448710 AATAATTGTTAAATGGATAACGG - Intronic
949851754 3:8427386-8427408 AATAATGATTAAAAGGAAAAAGG + Intergenic
949854844 3:8451928-8451950 CACAAAAATGAGATGGAGAACGG + Intergenic
949913143 3:8931878-8931900 CAAAGTAATTCAATGGGGAAAGG + Intronic
950341584 3:12250855-12250877 CATAATAGTAGAATGTAGAATGG + Intergenic
951053123 3:18117262-18117284 ATGAATAATTTAATGGAGAAGGG - Intronic
951147349 3:19243606-19243628 AACAAAACTTAAATGGAGAAAGG + Intronic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951465369 3:22995522-22995544 CATAAAAATTCAATTGAAAAGGG + Intergenic
951472755 3:23073652-23073674 CATCAGAATCAAGTGGAGAAAGG - Intergenic
951623411 3:24632372-24632394 AAAAACAATTCAATGGAGAAAGG - Intergenic
951974680 3:28491984-28492006 CATATTAATTAAAGGGACAACGG + Intronic
952350592 3:32532900-32532922 CTTTAAAATTAAATGTAGAAAGG - Intronic
952474442 3:33692231-33692253 AATTATAAGTAAATGGAAAATGG - Intronic
952571119 3:34717799-34717821 CTTAATATTTAAAGAGAGAAGGG - Intergenic
953022419 3:39123585-39123607 CATAAAAATTAAATGAAACATGG + Intronic
953094654 3:39763166-39763188 AAAAATAACTCAATGGAGAAAGG + Intergenic
953416796 3:42725963-42725985 CAAAATTATTTAAAGGAGAAAGG + Intronic
953535236 3:43772310-43772332 CAATATAATTTAATGGAAAATGG + Intergenic
953989332 3:47472136-47472158 AATAATAATTAAATGGGGCCGGG + Intronic
954848011 3:53576804-53576826 CATGAAAATTGAATGGATAAAGG - Intronic
955313359 3:57913089-57913111 CATAATACTTCAAAGGATAAAGG - Intronic
955693128 3:61609267-61609289 CATGAAAATTAAAATGAGAAAGG - Intronic
956604540 3:71060135-71060157 CATATTACTGAAAGGGAGAAGGG + Intronic
957795550 3:85001204-85001226 GTGAATAATTAAATAGAGAAAGG - Intronic
957890187 3:86346598-86346620 CAGAAAACTAAAATGGAGAAAGG + Intergenic
957901007 3:86489700-86489722 CATAATTAATAAATGGATCATGG + Intergenic
957938425 3:86973728-86973750 CTAAATAGTCAAATGGAGAAAGG - Intronic
958834487 3:99128662-99128684 TATAATAATAAAATGCATAAAGG + Intergenic
959830872 3:110860972-110860994 TATAACAATAAAATGGAGGAGGG - Intergenic
960536864 3:118824546-118824568 CATAAAAATCAACTGGAGAGTGG - Intergenic
960803646 3:121562552-121562574 AAAAATAATTAAATAGAGACAGG + Intergenic
960807666 3:121599500-121599522 CATAGTAATTAAAAGGGAAATGG + Intronic
961328075 3:126122432-126122454 AATAAAACTTAAATGGAGTAAGG + Intronic
961758733 3:129148969-129148991 GAAAACAATTCAATGGAGAAGGG - Intronic
961773381 3:129266643-129266665 CAGAATAATAAAAATGAGAAAGG - Intronic
962109851 3:132433031-132433053 TAGAATAATTACATGGGGAAAGG + Intronic
962160736 3:132997544-132997566 TATAATAATTAAAAATAGAAAGG - Intergenic
962833726 3:139167729-139167751 CAAAAAAAAGAAATGGAGAAAGG - Intronic
962924090 3:139975911-139975933 CATAAGAATTACATGTAGTACGG - Intronic
963625425 3:147666072-147666094 CATACAAATTGAATGGAGAGAGG + Intergenic
963835002 3:150049229-150049251 TAAAATAATTAGATGGTGAATGG + Intronic
963985330 3:151586849-151586871 CATTATAAGAAAATGGAGAGGGG + Intergenic
964132044 3:153300304-153300326 CAAAGAAATTAAATGGAGGAAGG + Intergenic
964412359 3:156411619-156411641 AAAGGTAATTAAATGGAGAAAGG - Intronic
964996415 3:162887793-162887815 AATGATAATAAAATAGAGAAAGG - Intergenic
965283535 3:166785361-166785383 CATTAAAATTAAATTGATAATGG - Intergenic
965421866 3:168470320-168470342 GATAATTATAAAATGGAGATAGG - Intergenic
965427086 3:168539983-168540005 CATTATAATTAAATGTACAAAGG + Intergenic
965460809 3:168960345-168960367 CAAAGTAATTCAATGGAGAAAGG - Intergenic
965573720 3:170196904-170196926 CAAAAATATTAAATGGAAAATGG + Intergenic
965681136 3:171252886-171252908 CAGAAAATTTAAATGGAGTAGGG + Intronic
965689031 3:171335660-171335682 CATACTTATCAAATGGAAAATGG - Intronic
965844141 3:172941798-172941820 CATAATAATTAATTTAAGGATGG + Intronic
966082729 3:176024657-176024679 AATGAGAATCAAATGGAGAATGG - Intergenic
966275695 3:178164838-178164860 CAAAGCAATTTAATGGAGAAAGG + Intergenic
966578256 3:181528305-181528327 CAAAATCATAAAATGGGGAAAGG - Intergenic
966707687 3:182934410-182934432 CAAGATAATTAAGTGGGGAAAGG + Intergenic
967233806 3:187365983-187366005 TATAAAAATTAAAGGGAAAAGGG + Intergenic
967715288 3:192755572-192755594 CATATTAATTAAATAGAGAATGG + Intronic
969835892 4:9841172-9841194 CATAAGAAGTAAATGAAGAGTGG - Intronic
969846936 4:9926734-9926756 CATATTAATTATATTGACAAAGG - Intronic
969953116 4:10860444-10860466 TATAATAATTAAATTTAGCATGG - Intergenic
970255091 4:14159623-14159645 GATAATTGTTAAATGGAAAAAGG - Intergenic
970285205 4:14505624-14505646 CATAGTGGTCAAATGGAGAAAGG - Intergenic
970389325 4:15591663-15591685 AATAATAATTAACATGAGAATGG - Intronic
970831060 4:20340383-20340405 TATAATACATAAATGAAGAATGG - Intronic
971237302 4:24854410-24854432 CATAATGAATAAATGAAGAAAGG + Intronic
971372757 4:26031444-26031466 AATAATAATTAAATCGAATATGG + Intergenic
971439044 4:26660120-26660142 CATAAGAATTAATTAGAGACTGG + Intronic
971533396 4:27717519-27717541 CTCAATAATTAAATCGAGAGGGG + Intergenic
971535398 4:27741886-27741908 AATAATAATTAAAAGCAAAAAGG - Intergenic
971543952 4:27860647-27860669 CATAATAATCAAATGCTCAAAGG - Intergenic
971628538 4:28958017-28958039 AATAATAATAAAAGTGAGAATGG - Intergenic
972923166 4:43968632-43968654 CACAAAAATTAAATTGAGATGGG - Intergenic
974103156 4:57439552-57439574 CATAGTAATTCAATAAAGAAAGG + Intergenic
974661631 4:64897776-64897798 CAGAATAATTAAACTGAGATTGG + Intergenic
974979669 4:68939430-68939452 CAAAATCAAGAAATGGAGAAAGG + Intronic
975374128 4:73622747-73622769 CATAATAATTAAATAAGTAACGG - Intergenic
975540466 4:75504882-75504904 CATTATACTTAAATGGTAAATGG + Intronic
976388459 4:84485004-84485026 CATAATAATCAGATGTACAAGGG + Intergenic
976974344 4:91148418-91148440 AATACTAATTAAATGAAGGAGGG - Intronic
977149867 4:93497611-93497633 CAAAACAATTCAATGAAGAAAGG - Intronic
977535966 4:98257359-98257381 AATATTAAATAAATGGAGAGCGG + Intergenic
977611808 4:99043272-99043294 TATAATAATTCAGGGGAGAAGGG - Exonic
978391347 4:108229037-108229059 CATAATAAAGAAATCAAGAAGGG + Intergenic
978881539 4:113709132-113709154 CTTAAAAACTAAATGGAAAAAGG - Intronic
978920575 4:114178173-114178195 CATGATAATGGAATGGGGAAAGG - Intergenic
979051679 4:115942995-115943017 CATAATTATTATAGGGAGATAGG + Intergenic
979065672 4:116129489-116129511 CAGAATAATTTAATGGAGAGAGG - Intergenic
980400082 4:132272420-132272442 AATAGTAATTCAATGGAAAAAGG + Intergenic
980424769 4:132613757-132613779 CATAAAAATTAAATAGAAAAAGG + Intergenic
980621386 4:135309247-135309269 CATAATTATTCTCTGGAGAAGGG - Intergenic
980637296 4:135524260-135524282 CAAAATAATAAAATGAAAAAGGG + Intergenic
980807181 4:137828751-137828773 CATAGAAAATAAATGGAAAATGG + Intergenic
980985211 4:139688792-139688814 TATAATAATTCAGTGGATAAGGG - Intronic
981212162 4:142120103-142120125 CAAGGTAATTCAATGGAGAATGG - Intronic
981250162 4:142591468-142591490 TTGAATAAATAAATGGAGAAAGG + Intronic
981619262 4:146675383-146675405 CATAGAAATTACAAGGAGAATGG + Intergenic
982001059 4:151021616-151021638 CTTAATAACCAAATAGAGAAGGG - Intergenic
982605438 4:157510703-157510725 CTTAAAAATAAAATGCAGAAAGG - Intergenic
983106907 4:163697865-163697887 AATAATAATAAAATGCAGAGTGG - Intronic
983606077 4:169585808-169585830 AACAATAATCAAATGGTGAAAGG + Intronic
983944729 4:173572796-173572818 AATAAGAATTTGATGGAGAAAGG - Intergenic
983996997 4:174194446-174194468 AAAAAGAATTAAAGGGAGAATGG + Intergenic
984250416 4:177326298-177326320 CAAAGAAATTCAATGGAGAAAGG - Intronic
984874943 4:184359141-184359163 CATAATAAATAAATAGAGCACGG + Intergenic
985156227 4:186989819-186989841 TATACTACTGAAATGGAGAAGGG - Intergenic
986086574 5:4457956-4457978 CAAAGTAATTCAATGGAGGAAGG + Intergenic
986100960 5:4610808-4610830 CATTATAAATAAAAGGAAAAGGG + Intergenic
986149311 5:5112366-5112388 CATAATAATTAAGGGGAGTCTGG - Intergenic
987052338 5:14158096-14158118 ATTAATATTTTAATGGAGAAGGG + Intronic
987492472 5:18598289-18598311 CAAAATAATTAAACAGAAAATGG + Intergenic
988379691 5:30484360-30484382 AATAATAATTAAATAAAGAATGG - Intergenic
988508827 5:31848372-31848394 CTGAATAATTAAATGTATAAAGG + Intronic
989453742 5:41617817-41617839 CCTAATAAAAAAAGGGAGAAAGG + Intergenic
990389428 5:55303814-55303836 GGTAAACATTAAATGGAGAATGG - Intronic
990414623 5:55574422-55574444 CAAAATAAATAAATGCACAAAGG + Intergenic
990504196 5:56428469-56428491 CATAATAAAAAAATGTAAAAAGG - Intergenic
990811573 5:59731054-59731076 AATAAGAATGAAAGGGAGAATGG - Intronic
991309162 5:65215824-65215846 AATAGTAATTAAATGGATATGGG + Intronic
992458482 5:76938732-76938754 CATAAAAATTAATTTGAGATGGG - Intergenic
992697860 5:79308469-79308491 CAAGACAATTCAATGGAGAAAGG - Intronic
992810988 5:80388325-80388347 CAAAATATTTAAATGGTCAAAGG - Intergenic
992982368 5:82189205-82189227 AATAATAACTAAATGGTGGATGG + Intronic
993217976 5:85049496-85049518 AATAATAATAATATAGAGAAAGG + Intergenic
993403573 5:87483724-87483746 AATAATAATAAAATGGTAAAAGG - Intergenic
993636314 5:90348290-90348312 CATAATTATGACATAGAGAAAGG + Intergenic
993748598 5:91635286-91635308 AATAATAATTAGCTGGTGAAAGG - Intergenic
995211644 5:109546792-109546814 CATACCAATTCCATGGAGAAAGG + Intergenic
995269178 5:110201790-110201812 CATAATATTTAACTGGAGAAAGG + Intergenic
995305607 5:110644343-110644365 TATAAAAATTAAATGGATGAAGG - Intronic
995802787 5:116017528-116017550 CACAATAAATAAAAGGACAAAGG - Intronic
996157263 5:120116859-120116881 CCTAAGAATTAAAAGTAGAAAGG + Intergenic
996202235 5:120690115-120690137 CCTAATTATTAAATGAATAAAGG + Intergenic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996340495 5:122433576-122433598 CAAATTTATGAAATGGAGAAAGG + Intronic
996492116 5:124110282-124110304 CCTGATAATTAACTGGAGACAGG - Intergenic
996988227 5:129594598-129594620 CATTATAATCAAATGGAAGAAGG - Intronic
997986293 5:138504046-138504068 AATAAGGATTAAATGGAGTAAGG - Intergenic
999052300 5:148535688-148535710 CAAAATAATTAAAAGGAATAAGG + Intronic
1000790896 5:165605859-165605881 CATCATAATTCCATGGGGAAGGG - Intergenic
1000813979 5:165898022-165898044 CATAAAAGATAAATGGACAAAGG - Intergenic
1001347876 5:170923264-170923286 AAAAACAATTCAATGGAGAAAGG - Intronic
1002619572 5:180478172-180478194 GAAAGTAATTCAATGGAGAAAGG - Intergenic
1002763820 6:222577-222599 CACAATGATTAAATGGACATTGG + Intergenic
1003046336 6:2736540-2736562 CATAATACTGAAATAGATAATGG + Intronic
1003323684 6:5075593-5075615 CATTATAATGAAAGGAAGAATGG + Intergenic
1003377899 6:5596055-5596077 CATAATAATTCAATGAGGTAAGG + Intronic
1003509690 6:6769184-6769206 AATAAAAAATAAAGGGAGAAGGG + Intergenic
1003984513 6:11421701-11421723 CAAAAACATTAAATGGAGAAGGG + Intergenic
1004794947 6:19071004-19071026 ATTAATATATAAATGGAGAAAGG + Intergenic
1004976810 6:20976893-20976915 CCTAATATTTAACAGGAGAATGG - Intronic
1005152571 6:22769384-22769406 CATAATATTTAAATACACAAAGG + Intergenic
1005517566 6:26569420-26569442 CATGACAATTAAAAGGAGAAGGG - Intergenic
1005519538 6:26587246-26587268 CAAAATAATTCAATGGAAAAAGG - Intergenic
1006298888 6:33182849-33182871 CAAAATAAGAACATGGAGAATGG + Intronic
1006527743 6:34621979-34622001 CAAAACAATTCAATGGTGAAAGG + Intronic
1007393718 6:41565398-41565420 TATAATAATGACATGAAGAAGGG - Intronic
1009228893 6:61040877-61040899 CATCATATTTAGAAGGAGAAAGG - Intergenic
1009309422 6:62132147-62132169 TATCATAATTAAATAGAGGATGG - Intronic
1009360579 6:62806508-62806530 CATATGAATGAAATAGAGAAAGG - Intergenic
1009369293 6:62880601-62880623 CATAATATTTAGGTGGAGAGAGG + Intergenic
1010800183 6:80166189-80166211 TATAATCATTAAATGTGGAAAGG + Intronic
1010892606 6:81333232-81333254 CATAATTATTAAATCTACAAAGG - Intergenic
1011712502 6:90068977-90068999 CAAAATAATCAAAGGAAGAAAGG - Intronic
1011940288 6:92834481-92834503 CATCATAATTAACTAGAGTAGGG - Intergenic
1012242942 6:96895060-96895082 CATTTTAAGTAAGTGGAGAAAGG + Intronic
1012482797 6:99686678-99686700 CAAAAAAATTTAATGGGGAAAGG - Intergenic
1012485309 6:99714990-99715012 TATAATAATCATATGGAGAATGG + Intergenic
1012642037 6:101630873-101630895 CATAATAAATAAATATGGAAAGG - Intronic
1012871568 6:104678944-104678966 AAAGATAATTCAATGGAGAAAGG + Intergenic
1012905332 6:105057994-105058016 CAAAATAATTAAATAAATAAGGG - Intronic
1013148287 6:107417056-107417078 TATAAAAATTAAATAGAGACGGG - Intronic
1013175618 6:107674160-107674182 CATAAGAATTACTTGAAGAATGG + Intergenic
1014494342 6:122102057-122102079 AAGAATGATTCAATGGAGAAAGG + Intergenic
1014626081 6:123727502-123727524 GATATTAAGGAAATGGAGAATGG - Intergenic
1014819114 6:125966483-125966505 GAAAAAAATTAAATGTAGAAAGG + Intronic
1015621030 6:135131792-135131814 AATAATAATTAAATAGAGACAGG + Intergenic
1015773973 6:136794586-136794608 AATAATAATTAAAGGAAGGAAGG + Intergenic
1015846000 6:137521503-137521525 CGTTATAATTAAAGGGAGATTGG + Intergenic
1015851898 6:137582822-137582844 AATAATAATTACTTAGAGAAAGG + Intergenic
1016180884 6:141147052-141147074 CATGATAACTAAATGGAATATGG - Intergenic
1017366711 6:153650778-153650800 CATGAAAATTAAATGATGAATGG - Intergenic
1017569068 6:155723061-155723083 CTTATTAATTAAATGGAACATGG + Intergenic
1018531355 6:164766929-164766951 CCTAGTGAATAAATGGAGAAGGG - Intergenic
1020620149 7:10507103-10507125 AATAATAATAAAATGAAAAAAGG + Intergenic
1020653256 7:10900391-10900413 GAGAAAAATTAAGTGGAGAAGGG - Intergenic
1020791995 7:12638620-12638642 TGTAATAATTAAATAGAGAGAGG + Intronic
1020858947 7:13463712-13463734 CATAATAGGTAAATGCATAATGG + Intergenic
1020873232 7:13660823-13660845 CAAGATCATTCAATGGAGAAAGG + Intergenic
1020995097 7:15253433-15253455 TAAAATAATTATCTGGAGAAGGG + Intronic
1021317349 7:19165240-19165262 AATAATAAGTACATGAAGAAAGG + Intergenic
1021532938 7:21669793-21669815 CACATTAATTCAATAGAGAAAGG - Intronic
1022485541 7:30774670-30774692 CATAATCATTAGATCAAGAAGGG - Intronic
1023201688 7:37704804-37704826 CATAATACATAAATCAAGAAAGG - Intronic
1024019271 7:45350553-45350575 AAGAAGAATTCAATGGAGAAAGG - Intergenic
1024850649 7:53712327-53712349 AAAAATAAGTAAATGGATAAAGG - Intergenic
1025724713 7:64045989-64046011 CACAATTTTTAAAAGGAGAAAGG - Intronic
1025994007 7:66516854-66516876 AATAATAATCAAATAGAGATGGG - Intergenic
1026432839 7:70365013-70365035 CATCATATGTAAATGGAGAAAGG + Intronic
1026627079 7:72004264-72004286 CAAAGTAATTCAATGGAGAAAGG + Intronic
1026685573 7:72506619-72506641 CATAATAATTTAAAGGACACAGG + Intergenic
1027561562 7:79738490-79738512 CATAAATTTTAAATGGAAAATGG + Intergenic
1027700106 7:81459201-81459223 TATAATATCTAAATGGAGTAGGG + Intergenic
1027830291 7:83168648-83168670 CATTTTAATAAAAGGGAGAAAGG - Intergenic
1028008663 7:85612542-85612564 CAAAAACATAAAATGGAGAAAGG + Intergenic
1028195236 7:87898979-87899001 GAAGATAATTTAATGGAGAAAGG + Intronic
1028203558 7:87990977-87990999 TAAAATAATTGAATGTAGAATGG + Intronic
1028310716 7:89331045-89331067 CATAATAATGGAATTGGGAAAGG + Intronic
1028606564 7:92662276-92662298 CATCTTAATTAACTGGAGATGGG + Intronic
1028932227 7:96426418-96426440 CATAAAAAAAAAATGAAGAAGGG + Intergenic
1030319045 7:108145411-108145433 GTTAATAAAGAAATGGAGAAGGG + Intergenic
1030656230 7:112171550-112171572 CATAATAATGTAATGGAACATGG + Intronic
1030728003 7:112949037-112949059 CAAAAACATAAAATGGAGAAAGG - Intergenic
1030777691 7:113554893-113554915 CAAAAGCATTAAATGGAGAAAGG + Intergenic
1030818268 7:114063695-114063717 CATAACATTTAAATGTAGAATGG - Intronic
1030946602 7:115730305-115730327 CATTTTAATTAAACGGAAAATGG - Intergenic
1031015177 7:116566978-116567000 CATTATAGTTTAAAGGAGAAAGG - Intergenic
1031295736 7:120000933-120000955 AATAAAAATTAAATGGAGAAAGG - Intergenic
1031813535 7:126403312-126403334 TATACTAATAAAATGAAGAAAGG + Intergenic
1031859957 7:126967186-126967208 CATGATATATAAAGGGAGAAAGG - Intronic
1032287499 7:130552191-130552213 CATAATTACTAAAAAGAGAAAGG + Intronic
1032549929 7:132775529-132775551 ATTAATAAATAAAAGGAGAAAGG - Intergenic
1033675187 7:143534090-143534112 TATAATTATTATATGGAGAAAGG - Intergenic
1033696649 7:143795351-143795373 TATAATTATTATATGGAGAAAGG + Intergenic
1033920329 7:146383466-146383488 AATAATACGTAAATGCAGAAAGG - Intronic
1034189832 7:149205454-149205476 AATAAAAATAAAATGAAGAAAGG + Intronic
1034395221 7:150818507-150818529 CAAAGCAATTCAATGGAGAAAGG + Intergenic
1034705906 7:153144146-153144168 TATAATAAAGGAATGGAGAAGGG + Intergenic
1036474552 8:9081302-9081324 CAAGATAATTAATGGGAGAAAGG + Intronic
1038121627 8:24623177-24623199 CAAAAGCATAAAATGGAGAAAGG + Intergenic
1038353218 8:26800395-26800417 AAAAATAATTCAATGGAGGAAGG + Intronic
1038485708 8:27933741-27933763 CATGATAAATAAACAGAGAAAGG - Intronic
1038862990 8:31408129-31408151 TAAAATAATTCAATGGAGAAAGG + Intergenic
1038982268 8:32772937-32772959 AATAAAAAGTAAAGGGAGAATGG - Intergenic
1039210627 8:35209143-35209165 CATAATAATGAGATGATGAAGGG + Intergenic
1039246497 8:35614349-35614371 CTTAATAATTCACTAGAGAAAGG + Intronic
1041006457 8:53500996-53501018 AATATTAATTAAATGAGGAAAGG + Intergenic
1041483652 8:58350125-58350147 AATAATAATATAATGTAGAATGG - Intergenic
1041727499 8:61031717-61031739 AATAATAATTCAATACAGAATGG + Intergenic
1042263799 8:66887814-66887836 CAAAACAATTTAATGGGGAAAGG - Intronic
1042407862 8:68425903-68425925 AAAAGTAATTCAATGGAGAAAGG + Intronic
1043471099 8:80563614-80563636 CATGGTAATTCAATAGAGAAAGG - Intergenic
1043559752 8:81478553-81478575 CATAATAATTCAAGGTAAAAAGG - Exonic
1043953381 8:86334953-86334975 CAAAGTAATTCAATGGGGAAAGG + Intergenic
1044307206 8:90651515-90651537 AATCATATTTAAATGGAAAATGG + Intronic
1044333498 8:90948282-90948304 CATAAGAATTAAATGGAAGGTGG - Intronic
1044379591 8:91518697-91518719 AAAAATAACTAAATGGTGAAAGG - Intergenic
1044889191 8:96814319-96814341 CAAAATAATTAGAAGAAGAAAGG - Intronic
1045475974 8:102552881-102552903 AATAATAAGTAAATATAGAAAGG + Intronic
1045916001 8:107471979-107472001 CATAATAAGTAAATGTAGTGTGG - Intronic
1046548881 8:115687025-115687047 CATATTGATTGAAAGGAGAAGGG - Intronic
1046767429 8:118084818-118084840 CGTATTAATAAAATGGAGACTGG + Intronic
1046974481 8:120258599-120258621 CATAATATTTACATGGGTAAAGG - Intronic
1047083677 8:121492879-121492901 CATAATGATTAAATGCAGTGTGG + Intergenic
1047556352 8:125935214-125935236 CAGAATATTTAACTGTAGAAAGG - Intergenic
1048075861 8:131070373-131070395 CAGAATAATGACAAGGAGAATGG + Intergenic
1048583275 8:135748754-135748776 TTTACTAATAAAATGGAGAAAGG + Intergenic
1050760021 9:9057375-9057397 CATTATGATAAAATGGAGATGGG - Intronic
1050985892 9:12081565-12081587 CATGATAATTAAATGCAATATGG + Intergenic
1051341369 9:16114428-16114450 CATGGTTATTCAATGGAGAAAGG + Intergenic
1052656304 9:31366146-31366168 AATAAAAATCAGATGGAGAAAGG + Intergenic
1052700342 9:31930676-31930698 CATATTCATTAAATAAAGAAGGG + Intergenic
1052977896 9:34425104-34425126 AATAATAATAAAAGTGAGAAAGG - Intronic
1053327116 9:37163934-37163956 AAAAATAATTCAATAGAGAAAGG - Intronic
1053334529 9:37253993-37254015 CATAATAATGGAATCGAAAAAGG - Intronic
1053552469 9:39098478-39098500 TATAGTAAGTAAATGGAAAATGG - Intronic
1055160206 9:73117462-73117484 CAAAATAACTACATGGAGACTGG + Intergenic
1055350071 9:75377762-75377784 CAAAATAATGACCTGGAGAAGGG + Intergenic
1055431178 9:76245831-76245853 CAGGATAATTAAAGGGAGAGAGG + Intronic
1055794279 9:79957718-79957740 GATAATAACTCTATGGAGAAAGG - Intergenic
1056614635 9:88153360-88153382 AAAAATAATTAAATGGAGGAAGG - Intergenic
1057018224 9:91673711-91673733 AAAAATAATTTGATGGAGAAAGG - Intronic
1057092776 9:92274727-92274749 CGAAATAATTATCTGGAGAATGG + Intronic
1057530869 9:95844796-95844818 CAAAATCATTCAATGGAGAAAGG - Intergenic
1057593529 9:96394535-96394557 CATAATAATCACATGGTAAATGG - Intronic
1057624585 9:96666311-96666333 CCTAATAGTAAACTGGAGAAGGG + Intergenic
1057809898 9:98249860-98249882 CTTTATAATTAAATGAGGAAAGG - Intronic
1058297014 9:103321865-103321887 GATAATAATTAGAACGAGAAGGG - Intergenic
1058677936 9:107416891-107416913 CCTAATTATTAAATGGGCAAAGG + Intergenic
1059323856 9:113490328-113490350 TAAAATAATTCACTGGAGAAGGG - Intronic
1059580290 9:115538982-115539004 CAAAGTAATTCAATGGAGAAAGG + Intergenic
1059743261 9:117175547-117175569 CATAATAACTAAAAGTAGCATGG + Intronic
1060036449 9:120260088-120260110 AATAATAACTAAATGAATAAAGG + Intergenic
1060291785 9:122309581-122309603 AAAAATAATTAAGTGGGGAAAGG - Intronic
1060573267 9:124663705-124663727 TTTAAAATTTAAATGGAGAATGG - Intronic
1060654383 9:125359026-125359048 GATATTAATTACATGGAGAAGGG - Intronic
1060800220 9:126539750-126539772 CACAATATTTAGATTGAGAATGG - Intergenic
1060810413 9:126608851-126608873 CATAATAATTGGATGGAAGAGGG - Intergenic
1061082032 9:128377025-128377047 AATAATAATTACATAGAGACAGG + Intronic
1061665434 9:132158256-132158278 CATAATAATTAATGGGAGTATGG + Intergenic
1062487937 9:136790321-136790343 CATAATAATTCTTTGAAGAAAGG + Intergenic
1185548971 X:968400-968422 AATAACAATTAAATGGAAATGGG - Intergenic
1185996468 X:4955870-4955892 AATAATAGTTAACTAGAGAAAGG - Intergenic
1186091086 X:6049639-6049661 CCTGAGAATTAAATGGACAAAGG - Intronic
1186299064 X:8178987-8179009 AATAGTAATTAAATCGAGGAGGG + Intergenic
1186344482 X:8677842-8677864 AGTAATAATAAAATGGAGGAGGG + Intronic
1186365592 X:8889888-8889910 CATCATATTTAACTGTAGAAAGG + Intergenic
1187436966 X:19279993-19280015 CATATTACTTAAATGGAAAAAGG + Intergenic
1187580286 X:20600088-20600110 CATATTAATTAATTTGAGCACGG + Intergenic
1187756455 X:22532569-22532591 CAAAAAAATAAAGTGGAGAAGGG + Intergenic
1187766477 X:22648204-22648226 CAGAATAGTTATATGGGGAAGGG - Intergenic
1188658232 X:32725882-32725904 AATAATAATCACATGGAGAATGG - Intronic
1188934255 X:36153897-36153919 CAGAATAATTTTAAGGAGAAGGG - Intergenic
1188986367 X:36771961-36771983 GAAAGTAAATAAATGGAGAAGGG - Intergenic
1189971622 X:46423459-46423481 CAGGACAATTCAATGGAGAAAGG - Intergenic
1191019446 X:55843439-55843461 GAGAAGAATTCAATGGAGAAGGG - Intergenic
1191725833 X:64279865-64279887 CAAGATAATTCAATGCAGAAAGG + Intronic
1191837397 X:65479119-65479141 AATAATAATTCTATGGAGATGGG + Intronic
1192820638 X:74641566-74641588 CAAAAATATCAAATGGAGAAAGG + Intergenic
1193320233 X:80113591-80113613 GATAATAATTGAATAGACAAAGG + Intergenic
1193608341 X:83595932-83595954 CATATTAAGTAAATAGATAATGG + Intergenic
1193655842 X:84196521-84196543 AATAATAACATAATGGAGAATGG + Intergenic
1193779860 X:85687993-85688015 CATAATAGTTAAATGTATAAAGG + Intergenic
1194109983 X:89821856-89821878 CTTATTAAATAAATGGAGCAGGG - Intergenic
1194180639 X:90707217-90707239 CAAAATATTTCAATGGATAAGGG + Intergenic
1195547710 X:106131578-106131600 AATAATCATGTAATGGAGAATGG - Intergenic
1196371906 X:114988587-114988609 CATAAGTATTCCATGGAGAAAGG - Intergenic
1196561792 X:117158219-117158241 CATAAGAATTAATTGTAGACTGG - Intergenic
1197201127 X:123749541-123749563 CATAAAAATAAAGTGGAGCAAGG + Intergenic
1197580436 X:128276139-128276161 AAAAATGATTAAATGGATAAAGG + Intergenic
1198140238 X:133795395-133795417 GATATTAAATAAATGGATAAGGG + Intronic
1198387165 X:136140243-136140265 TATAATATTTAAATGGCTAATGG + Intergenic
1198488581 X:137114211-137114233 CAGAAAAACTAAATGGCGAAAGG - Intergenic
1198978897 X:142370785-142370807 CATCATAATTAACTGGGAAATGG + Intergenic
1199115004 X:143981496-143981518 AATAATCATATAATGGAGAATGG + Intergenic
1199123373 X:144084879-144084901 CGTATAAAATAAATGGAGAAAGG + Intergenic
1199142511 X:144330565-144330587 AATTACAATTCAATGGAGAAAGG + Intergenic
1199405306 X:147451362-147451384 CAAAGCAATTAAATGGAAAAAGG + Intergenic
1199457582 X:148045778-148045800 CATAATAAGTCAAGGAAGAAAGG - Intergenic
1199828648 X:151526102-151526124 AATAATAATCTAGTGGAGAAAGG + Intergenic
1200327041 X:155251642-155251664 TTTAATAATTTAATGGGGAAAGG - Intergenic
1200527299 Y:4289373-4289395 CAAAATATTTCAATGGATAAGGG + Intergenic
1201747123 Y:17388984-17389006 AATAATGAATAAATGAAGAATGG + Intergenic
1201898278 Y:19017490-19017512 CTTAATAATTAAAGGGAAAATGG + Intergenic