ID: 1177209838

View in Genome Browser
Species Human (GRCh38)
Location 21:18057438-18057460
Sequence CAGAATGTTGATATGGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177209838 Original CRISPR CAGAATGTTGATATGGAATG AGG (reversed) Intronic
900433411 1:2613481-2613503 CAGAAAGTTGAAATTGACTGTGG + Intronic
901522609 1:9796863-9796885 CAGAATGAACAGATGGAATGTGG + Intronic
902980435 1:20118927-20118949 CACAATTTTGAGATGGATTGAGG + Intronic
906056581 1:42922876-42922898 CAGAATGTGGTTAAGGAATTTGG + Intergenic
906827609 1:48998461-48998483 GAGAATGTTCATAGGAAATGTGG - Intronic
907138595 1:52163176-52163198 CAGAAAGTTAAAATTGAATGGGG - Intronic
907718590 1:56950835-56950857 AAGAATGTTGGTATGGAGAGCGG + Intronic
907751095 1:57263908-57263930 TAGAATGTGGGTTTGGAATGAGG - Intronic
908399618 1:63758870-63758892 CAGAATGTAGATATGCAGTCAGG - Intergenic
908846488 1:68329605-68329627 CAGAGTGTTGAGAGGAAATGAGG - Intergenic
910729175 1:90372291-90372313 CAGAATGTTGATAAAGAAAAAGG - Intergenic
913358644 1:117953540-117953562 CAGTAAGTTGATATAGAATGTGG + Exonic
916069260 1:161160497-161160519 AAGATTGTGGGTATGGAATGGGG + Exonic
916069859 1:161163610-161163632 AAGATTGTGGGTATGGAATGGGG + Exonic
918921896 1:190722991-190723013 GACAATGTTGATTAGGAATGGGG + Intergenic
919998051 1:202772401-202772423 CAGAATGTTGATATGGTAAAAGG - Intronic
920682553 1:208083908-208083930 CTGAATGGGGATGTGGAATGGGG + Intronic
923267774 1:232331009-232331031 CTGAATGTTGATATGGTCTGTGG - Intergenic
1062864441 10:839318-839340 CGGAATGTTCATATGGGAAGAGG + Intronic
1065366856 10:24945244-24945266 CAGAATGCTGATCTGGAATATGG + Intronic
1066644897 10:37596442-37596464 CACACTGGTGAGATGGAATGTGG - Intergenic
1067740195 10:48889738-48889760 GAGAAAGTTGATTGGGAATGAGG + Intronic
1068562304 10:58528653-58528675 CAAAATGTTGATTAGGAATTAGG + Intronic
1068901248 10:62271460-62271482 CAGAAGGAGGCTATGGAATGTGG + Intergenic
1069389504 10:67918809-67918831 CAGAAAGTTGATACCAAATGTGG - Intergenic
1069747218 10:70723302-70723324 CAGGAAGTTTAAATGGAATGTGG + Intronic
1070084897 10:73227695-73227717 CAGAATGTGGCTAGGGAGTGAGG - Intronic
1070091716 10:73292901-73292923 CAGAATCTTGACCTGGAATCAGG - Intronic
1070341793 10:75504730-75504752 TAGAAGGTTGGTATGGAGTGTGG + Intronic
1070438342 10:76415558-76415580 GAGAATGTTAATATGGAAACTGG - Intronic
1071100254 10:82028614-82028636 CAGAATGTTGCTTTGCACTGTGG - Intronic
1071597952 10:86941895-86941917 AAGAATGTGGATAGGGACTGTGG - Intronic
1072392698 10:95004339-95004361 AAGAATGATGAAATGGACTGTGG - Intergenic
1073110323 10:101059507-101059529 CAGAATGATGAGCTGGAGTGTGG - Intergenic
1074178103 10:111031635-111031657 CAGAATGGTGATATAAATTGTGG - Intergenic
1075937078 10:126351601-126351623 CAGCATGTTGATGTAGCATGTGG - Intronic
1075989129 10:126818577-126818599 CAGACTGTCGTTATGGAAAGTGG - Intergenic
1076151942 10:128169509-128169531 CAGAATTTTTTAATGGAATGTGG + Intergenic
1078949361 11:16112035-16112057 CAGATTGCAGATTTGGAATGAGG - Intronic
1081684738 11:45034422-45034444 TAGAATGTGGATATGGAGTAAGG - Intergenic
1081865224 11:46356044-46356066 CAGGGTGTTAATATTGAATGAGG + Intronic
1082169985 11:48992154-48992176 CTGAATGTTGATCTGGAAATTGG + Intergenic
1083891945 11:65599910-65599932 CAGAATGTGGGTATGTGATGGGG - Intronic
1086569054 11:88262466-88262488 CAGAGTGTTGACAGGGAATGTGG - Intergenic
1086695844 11:89844473-89844495 CTGAATGTTGATCTGGAAATTGG - Intergenic
1086710310 11:90000010-90000032 CTGAATGTTGATCTGGAAATTGG + Intergenic
1087145592 11:94807790-94807812 CAGCCCTTTGATATGGAATGTGG + Intronic
1087146065 11:94812916-94812938 CAGCCCTTTGATATGGAATGTGG - Intronic
1087800112 11:102494514-102494536 CATAATTTTGATATGAAAAGTGG - Intronic
1088303406 11:108383258-108383280 AAGAATGGTGAAAAGGAATGTGG - Intronic
1090237181 11:125158015-125158037 CAGAATGGTGGTTTGGAGTGTGG + Intergenic
1093794328 12:23293031-23293053 CAGAATCTGGCTATGGAAAGAGG - Intergenic
1094182138 12:27603466-27603488 CATGATTTTGATATGGAATCAGG - Intronic
1097561784 12:61216152-61216174 TAAAATTTTGATATGGAAAGTGG - Intergenic
1098813456 12:75125848-75125870 CAGAATTCTGATGAGGAATGAGG - Intronic
1098860603 12:75705849-75705871 CAGAATGGGGAAATGGAATGAGG - Intergenic
1098939190 12:76515541-76515563 CAGAGTGTTGAGAGGGAACGTGG - Intronic
1103274976 12:119703914-119703936 CAGTATTTTGATATGTAATTAGG - Intronic
1103650104 12:122425230-122425252 CAGAATGTAAATATTGAAGGAGG - Intergenic
1104439374 12:128782358-128782380 CAGAATGTTCGTATGGAACCTGG - Intergenic
1104769291 12:131350942-131350964 CAGAAAGAAGATGTGGAATGTGG + Intergenic
1105292901 13:19063842-19063864 CAAAATGTTGCTATGGGAGGGGG + Intergenic
1105901814 13:24761889-24761911 CATAATGTGGATATTTAATGTGG - Intergenic
1106807016 13:33319977-33319999 GAGGATGTTGAGATGGAATGAGG - Intronic
1108331403 13:49388598-49388620 CAAAAAGATGAGATGGAATGAGG + Intronic
1110324921 13:74202699-74202721 CATAATTTGGATATGGAATGGGG - Intergenic
1110400681 13:75087834-75087856 CAGAATGCTGTTATAAAATGAGG + Intergenic
1110526385 13:76543233-76543255 CATCATGGTGATATGGAGTGGGG - Intergenic
1110713759 13:78678202-78678224 CAGAATGTTGATAAGAATTAGGG - Intergenic
1110984169 13:81941887-81941909 CAGGATGTTGATCAGGGATGCGG + Intergenic
1111505199 13:89180025-89180047 CATAATTGTGATATGAAATGTGG - Intergenic
1111506860 13:89201952-89201974 CAGAATGTTTTGATCGAATGAGG - Intergenic
1112173959 13:97002795-97002817 GAGGAGGTTGAAATGGAATGTGG + Intergenic
1112698585 13:101978285-101978307 CAGAATGGTGATATTTGATGTGG + Intronic
1116593658 14:46812051-46812073 CAGAATGCTCATATGGACTTGGG + Intergenic
1117328409 14:54689591-54689613 CAGAATGATAATATGGCGTGGGG - Intronic
1117476365 14:56099122-56099144 CAGACTGTAGCTATGGAAAGGGG - Intergenic
1121718831 14:96095445-96095467 CAGAATGTCCATCTGTAATGTGG + Intergenic
1125406801 15:39360992-39361014 CAGAATTTGAATATGGACTGTGG + Intergenic
1125813431 15:42562806-42562828 GAGTAAGTTGAAATGGAATGAGG + Intronic
1126057757 15:44747780-44747802 GAGAATGTAGACATGGAATGAGG + Intronic
1127143860 15:56004862-56004884 CAGAAGGTTGAATTGGAATAAGG + Intergenic
1127795925 15:62438276-62438298 CAGAATGTTTAAAGGGAGTGGGG + Intronic
1128026825 15:64444911-64444933 CAGAATGTTGAGGTGAAATCTGG + Intronic
1128402380 15:67296713-67296735 CAGTATGTTGTGATGAAATGAGG + Intronic
1129955701 15:79634916-79634938 CAGGATGGTGATAGGAAATGGGG + Intergenic
1130603599 15:85295353-85295375 CAGAATGTTGGCATGGAGTGGGG - Intergenic
1131228473 15:90643977-90643999 CAGAAGATAGAAATGGAATGAGG - Intronic
1131285139 15:91050696-91050718 CAGAATGTTGGCATGGGGTGGGG + Intergenic
1131764236 15:95658181-95658203 CAGCAAGATGATAGGGAATGTGG - Intergenic
1135744850 16:25008149-25008171 CAAAATGGTGATAGGGATTGTGG - Intronic
1135873826 16:26178442-26178464 AAGTATGATGATTTGGAATGTGG - Intergenic
1139752214 16:69115845-69115867 TGGAATGTTGATGTGGAGTGGGG - Exonic
1141588803 16:85053427-85053449 CAACATGTTGATAGAGAATGTGG - Intronic
1143065576 17:4244617-4244639 CAGGGTGTTGGCATGGAATGAGG - Intronic
1148643345 17:49204588-49204610 CAGAATGGTGAGATGGAGTCAGG + Intronic
1150109350 17:62484637-62484659 CAGACTATTGATTTGAAATGGGG + Intronic
1153029590 18:701342-701364 CAGAATGTTGATAATGAAGGAGG + Intronic
1153782047 18:8503638-8503660 CAAAATGTTGAGGAGGAATGTGG + Intergenic
1153811477 18:8755726-8755748 CAGAATGTTCACAGGGAGTGGGG + Intronic
1155990742 18:32276659-32276681 CAGAATGATGATCTGGTCTGTGG + Intronic
1159213378 18:65359148-65359170 CAGAATTTCTATATGGAAAGAGG - Intergenic
1159792810 18:72804393-72804415 CAGAAAGTTCATCTGCAATGTGG - Intronic
1159920882 18:74226568-74226590 CAGTATCTGGATATGGTATGAGG + Intergenic
1160367613 18:78341470-78341492 CACAATGTTGAATGGGAATGGGG + Intergenic
1163191564 19:15680452-15680474 CAGGATGTTGAAATGGAAGGCGG - Exonic
1163201652 19:15774108-15774130 CAGGATGTTGAAATGGAAGGCGG + Intergenic
1163204181 19:15790222-15790244 AAGAAGGTTCATCTGGAATGGGG + Intergenic
1163230285 19:15997348-15997370 CAGCATGTTGAAATGGAAGGCGG + Intergenic
1166399978 19:42471451-42471473 CAGAATGTTAACAAGGATTGAGG + Intergenic
925372438 2:3356575-3356597 TAGAATGTGGATATGGATGGAGG - Intronic
928741708 2:34362168-34362190 CAGAATGTTGAACTGGAAGATGG + Intergenic
929192743 2:39154767-39154789 CACAATGATGAAATGCAATGTGG - Intergenic
929967571 2:46547127-46547149 CAGAGAGTTAAGATGGAATGAGG + Intronic
932801991 2:74749016-74749038 CAGAATGTTTATATGCACTCTGG + Intergenic
933127412 2:78626607-78626629 GAAAATGTTGATATAGATTGTGG + Intergenic
935288445 2:101587927-101587949 CAGATTGTTGCCATGGAAAGGGG + Intergenic
939426146 2:142039282-142039304 TATAATGTTAATATGCAATGGGG - Intronic
944191611 2:197009943-197009965 CAGTATGATTATATGGAATTGGG - Intronic
947137076 2:226986024-226986046 CAGCACGTTGATATGTGATGAGG + Intronic
1170337824 20:15290370-15290392 CAGAGTGTTGATTTGGAGGGGGG + Intronic
1177209838 21:18057438-18057460 CAGAATGTTGATATGGAATGAGG - Intronic
1178213682 21:30568853-30568875 TAAAATGTTGATATGGGATGGGG + Intergenic
1178275342 21:31231674-31231696 TGGAATGTTGTTATGTAATGGGG + Intronic
1179368648 21:40783135-40783157 CGGAATGTTGTTATTGAATTAGG - Intronic
1180615433 22:17122892-17122914 CAGAATGTTGATCTGTAAACAGG + Intronic
1184806716 22:46799524-46799546 CAGAATGTGACTATGGACTGTGG - Intronic
949731050 3:7113370-7113392 CAGGATGTAGATAAGGAACGAGG - Intronic
953140184 3:40222296-40222318 CAGATTGTTGCTATGAAAAGGGG + Intronic
956641284 3:71417930-71417952 CAGACTGTGGATAGGAAATGTGG + Intronic
956997251 3:74841545-74841567 CAGATTTTAGATATAGAATGAGG + Intergenic
957014844 3:75051105-75051127 CAGAATGTTGATAGTAAAGGAGG + Intergenic
957261038 3:77901609-77901631 CAAAATGTAAATATGGTATGAGG + Intergenic
957784560 3:84865188-84865210 AGAAATGTTGACATGGAATGAGG + Intergenic
957953958 3:87160257-87160279 CAGCATGTTGAGATGAAATTGGG - Intergenic
958651647 3:96943506-96943528 CAGAATATTGAAATGCACTGGGG + Intronic
959185699 3:103044654-103044676 AAGAATGTTGTTATTGAATTTGG + Intergenic
959368691 3:105495217-105495239 CAGATTTCTGATGTGGAATGTGG - Intronic
959953611 3:112210748-112210770 CAGAATGTTTATTAGAAATGTGG - Intronic
961351139 3:126304622-126304644 CTGAATGATGAAATCGAATGAGG - Intergenic
962038537 3:131680844-131680866 AAGAATGATGCTATGGACTGTGG - Intronic
963239944 3:142992776-142992798 AGGAATATTGATATGGAAGGGGG - Intronic
963304789 3:143639643-143639665 CTGAATGTTGGTATGGATTTAGG + Intronic
966212735 3:177469877-177469899 CAGAAAGTAGATCTGGAAGGGGG + Intergenic
967945973 3:194804554-194804576 CGGAATGTAGAGATGGAAGGTGG + Intergenic
968377562 4:55654-55676 CAGGATGTAGATTTGCAATGTGG - Intronic
970159278 4:13172708-13172730 CATAATGTTGACATTCAATGGGG - Intergenic
972411087 4:38795594-38795616 CAGAATTTTCATTTGGACTGAGG + Intronic
973268074 4:48231332-48231354 CAAAATTTTAATATGGAATAAGG - Intronic
975770739 4:77719583-77719605 CAGAAGGTTGAATTGGAATAAGG + Exonic
976889254 4:90025594-90025616 GAAAATGTTAATATGGGATGTGG - Intergenic
977981086 4:103322873-103322895 CAGTATGTTGGGATAGAATGCGG - Intergenic
978015457 4:103739362-103739384 CAGATTGTTGAGATGCAGTGGGG + Intergenic
978996326 4:115158797-115158819 CAGAATGGTAATATGCAATGTGG + Intergenic
980149717 4:129030862-129030884 CAGAATATTGATGTAGAATTCGG - Intronic
985074241 4:186196981-186197003 CAGAATGGTAAAATGGAAAGTGG - Exonic
987403737 5:17503680-17503702 CAGAAAGTTGATAGTGAAGGGGG - Intergenic
987413626 5:17639745-17639767 CAGAAAGTTGATAGTGAAGGGGG - Intergenic
988933470 5:36059996-36060018 CTGAATGTGAAGATGGAATGAGG + Intronic
992671341 5:79063979-79064001 CAGAATCATTATATGGAATGGGG - Intronic
993563349 5:89440705-89440727 TAAAATGTGAATATGGAATGTGG - Intergenic
993740674 5:91534782-91534804 CAAAATGTTCATATGGAAAGGGG - Intergenic
995421469 5:111972274-111972296 CATACTGTTGATGTTGAATGTGG + Intronic
996011943 5:118490469-118490491 CAGTCTGGTGATATTGAATGTGG + Intergenic
996096673 5:119406637-119406659 CAGAATGTTAAGACGGAATTTGG - Intergenic
997275684 5:132586148-132586170 CAGAATCTTAATATGATATGAGG + Intronic
997812211 5:136982308-136982330 CAGAAAGTTGAAATTAAATGAGG - Intronic
1000213377 5:159130789-159130811 CAGAAGGCTGATAGGGGATGGGG + Intergenic
1002413969 5:179108541-179108563 CAGAAGGTTAAAATGGAATGGGG + Intergenic
1004801219 6:19150586-19150608 CAGAATGGGGTGATGGAATGTGG + Intergenic
1008445664 6:51587080-51587102 CAAAATGTTGATAGTGAATATGG - Intergenic
1010935350 6:81853910-81853932 CAGTGTGTAAATATGGAATGGGG + Intergenic
1011907656 6:92392306-92392328 CAGAATGTAGGGATGGAGTGGGG - Intergenic
1012822451 6:104103213-104103235 CAGGATGTTGATAGTGAAGGAGG + Intergenic
1013564596 6:111345278-111345300 CAGAATGTTAATATATAATTAGG + Intronic
1015363070 6:132363669-132363691 CAGTGTGTTCATATGGAAAGTGG + Intronic
1015722992 6:136265091-136265113 CAGAAGGTTAAGAGGGAATGAGG - Intronic
1016795415 6:148112390-148112412 CAGAATATAAATATAGAATGAGG - Intergenic
1016930973 6:149408789-149408811 TAGAATGTTTATATGGATAGTGG - Intronic
1017373186 6:153736563-153736585 CAGAATATGGAGATGAAATGGGG - Intergenic
1018257882 6:161940738-161940760 CAGAATGTCTATGTGGCATGTGG + Intronic
1018309647 6:162494443-162494465 GAGAAGGTTGATATGAAGTGGGG - Intronic
1019752764 7:2742671-2742693 CAGAGTTTTGATTTTGAATGAGG + Intronic
1021107956 7:16660459-16660481 CAGAGTGTTACTTTGGAATGTGG + Intronic
1021596297 7:22320577-22320599 AAGAATGTTAAAATGGAAAGAGG - Intronic
1022595035 7:31705264-31705286 CAGAAAGTTGATCTGGATTTGGG + Intronic
1022889520 7:34682164-34682186 CAGAATGTTAACAAGGAATAGGG + Intronic
1022915114 7:34941008-34941030 CAAAGTGTTGTTATGGAGTGTGG - Intronic
1023766359 7:43514593-43514615 AAGAATGAAGATATGAAATGTGG - Intronic
1024809791 7:53195283-53195305 CAAAATGTTTACATGGAATATGG + Intergenic
1025164002 7:56694472-56694494 CAGAATCTGGAAATGAAATGAGG + Intergenic
1025706288 7:63867610-63867632 CAGAATCTGGAAATGAAATGAGG - Intergenic
1025840825 7:65144413-65144435 CAAAATGGTGAAATGAAATGAGG + Intergenic
1025877889 7:65505673-65505695 CAAAATGGTGAAATGAAATGAGG - Intergenic
1025882224 7:65551573-65551595 CAAAATGGTGAAATGAAATGAGG - Intergenic
1025891218 7:65651029-65651051 CAAAATGGTGAAATGAAATGAGG + Intergenic
1026384466 7:69832295-69832317 CAGAATGGTGATTTTGAATATGG + Intronic
1027454304 7:78368701-78368723 AATACTGTTGATTTGGAATGAGG + Intronic
1027944955 7:84732879-84732901 CAGTTAGTTCATATGGAATGTGG - Intergenic
1028260872 7:88663052-88663074 CAGAATTTTGATTAGGATTGAGG + Intergenic
1028674912 7:93447917-93447939 GAGAATGCAGATTTGGAATGTGG + Intronic
1032038371 7:128537153-128537175 CAGACTATTGATTTGAAATGGGG + Intergenic
1034302910 7:150031886-150031908 GGGAATGTTGGAATGGAATGTGG + Intergenic
1034826813 7:154272820-154272842 CAGAAGATTGATATGCAAGGAGG - Intronic
1036052898 8:5219799-5219821 CAGAATGAGGCTGTGGAATGTGG + Intergenic
1036576905 8:10036173-10036195 CAGAATGTTGAGTAGAAATGTGG - Intergenic
1037268675 8:17100107-17100129 CAGAATGTTGAGTTGGGAAGAGG - Intronic
1037866754 8:22450248-22450270 CAGACAGTTGATGTGGAAAGTGG + Intronic
1038893737 8:31756998-31757020 GAGAATGGTGATATTGAATGCGG - Intronic
1039847168 8:41333803-41333825 CAGATTGTTGTCATGGAAAGGGG - Intergenic
1042689294 8:71479415-71479437 TAGCATGTTAAAATGGAATGTGG - Intronic
1043651850 8:82604952-82604974 CAGATTGTTAATAAGGAAGGTGG + Intergenic
1044191474 8:89323851-89323873 CAGCATGTAGGAATGGAATGGGG - Intergenic
1044949602 8:97422738-97422760 CATAATGTTGATATGGCAAGTGG - Intergenic
1045759929 8:105592897-105592919 GAGAATTTCGATATGAAATGAGG - Intronic
1048545212 8:135380333-135380355 GAAAATGCTGTTATGGAATGAGG - Intergenic
1050478660 9:6067180-6067202 CAGAATGTGGATACTGAACGTGG + Intergenic
1050879532 9:10681537-10681559 CTGTATGTTTATATGGTATGGGG - Intergenic
1055167619 9:73216756-73216778 CCACATGTTGATATGGACTGTGG - Intergenic
1055404945 9:75964813-75964835 CAAATTGTTGATTTGGAATATGG - Intronic
1203571675 Un_KI270744v1:138593-138615 CAGGATGTAGATTTGCAATGTGG + Intergenic
1185708734 X:2285118-2285140 CAGAAGGTGGAGGTGGAATGTGG + Intronic
1185973490 X:4691599-4691621 CTGAATGCTGGTATGGAAAGTGG + Intergenic
1186078821 X:5908421-5908443 CAGTATGTCGATAAGGGATGCGG - Intronic
1186126047 X:6414970-6414992 CAAAATGTTGTTATTGAATTTGG - Intergenic
1186965133 X:14778792-14778814 CAGAATTTGGAAATGGAAGGTGG + Intergenic
1187553268 X:20326966-20326988 CAGAAAGTTGATTTGGGAGGTGG - Intergenic
1188992921 X:36845844-36845866 CAGGATGGGGATATGGAAGGAGG + Intergenic
1189851624 X:45183008-45183030 CAGTATCTTGATATGGATGGTGG + Intronic
1194970764 X:100341081-100341103 CAGAATGTTTAGATGGACTTGGG - Intronic
1195282189 X:103347464-103347486 CATAATGGTGATAATGAATGAGG + Intergenic
1197063839 X:122215177-122215199 AAGAATGGTGTTATGTAATGTGG - Intergenic
1197657415 X:129132136-129132158 CAGAATTTTGATAAGAAAGGTGG + Intergenic
1198503445 X:137277335-137277357 CATATTGTGGATGTGGAATGGGG + Intergenic
1200756524 Y:6995306-6995328 CAGAAGGGTGGTATGGGATGGGG - Intronic
1200883149 Y:8241410-8241432 AAAAATATTGATATGGAAGGGGG - Intergenic
1200883623 Y:8246049-8246071 TAAAATATTGATATGGAAGGGGG - Intergenic
1200955110 Y:8937079-8937101 AAAAATATTGATATAGAATGGGG + Intergenic
1200958960 Y:8979914-8979936 AAAAATATTGATATGGAAGGGGG + Intergenic
1200985342 Y:9297313-9297335 AAAAATATTGATATGGAAGGGGG - Intergenic
1201761581 Y:17545256-17545278 CAAAATGTTGATGGAGAATGAGG + Intergenic
1201839971 Y:18360734-18360756 CAAAATGTTGATGGAGAATGAGG - Intergenic
1202125186 Y:21563438-21563460 AAAAATATTGATATGGAAGGGGG + Intergenic
1202153822 Y:21865954-21865976 AAAAATATTGATATGGAAGGGGG - Intergenic