ID: 1177215514

View in Genome Browser
Species Human (GRCh38)
Location 21:18123308-18123330
Sequence CCGTATCTACAGGAGCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 1, 2: 2, 3: 11, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177215514_1177215521 16 Left 1177215514 21:18123308-18123330 CCACTCTGCTCCTGTAGATACGG 0: 1
1: 1
2: 2
3: 11
4: 96
Right 1177215521 21:18123347-18123369 ACCTTCTTATTAAGGAGACTAGG 0: 1
1: 0
2: 0
3: 15
4: 176
1177215514_1177215520 8 Left 1177215514 21:18123308-18123330 CCACTCTGCTCCTGTAGATACGG 0: 1
1: 1
2: 2
3: 11
4: 96
Right 1177215520 21:18123339-18123361 ACAAACAAACCTTCTTATTAAGG 0: 1
1: 0
2: 4
3: 21
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177215514 Original CRISPR CCGTATCTACAGGAGCAGAG TGG (reversed) Intronic
904291551 1:29489039-29489061 CCTGATCTCCAGGACCAGAGTGG - Intergenic
904296993 1:29526230-29526252 CAGAATGTACAGGAGGAGAGTGG + Intergenic
906194215 1:43920030-43920052 CCCTATCTGCAGCAGCTGAGGGG - Intronic
909043013 1:70676049-70676071 CCTTATCTGTGGGAGCAGAGTGG + Intergenic
917214244 1:172661422-172661444 CCATATGTACACAAGCAGAGTGG + Intronic
1063881333 10:10535782-10535804 CCTTATCCACAGGAGCAGAATGG + Intergenic
1065419944 10:25531936-25531958 CTATTTCTAGAGGAGCAGAGTGG - Intronic
1065734214 10:28736734-28736756 TCCTATCTACAGGAACAGTGGGG + Intergenic
1067124665 10:43506166-43506188 CTTCATCTACAGGAGCAAAGTGG - Intergenic
1071787097 10:88913400-88913422 CCCTGTTTACAGGAGGAGAGTGG - Exonic
1076626681 10:131825120-131825142 CCCTGTCCTCAGGAGCAGAGGGG + Intergenic
1078107448 11:8367435-8367457 CAGTACCTAAAGAAGCAGAGAGG - Intergenic
1081149874 11:39614992-39615014 TCGGCTCTGCAGGAGCAGAGCGG + Intergenic
1081448934 11:43154576-43154598 CCGAATATCCAGGAGAAGAGAGG + Intergenic
1081449990 11:43161640-43161662 CCTAATATACAGGAGAAGAGAGG + Intergenic
1082062475 11:47872584-47872606 TCTTATCCACCGGAGCAGAGTGG + Intergenic
1083583071 11:63837760-63837782 CCAAAGGTACAGGAGCAGAGAGG - Intergenic
1084225338 11:67711721-67711743 CCGTACGAACAGGCGCAGAGGGG - Intergenic
1085314316 11:75535167-75535189 CCTTATCTCCAGGAGCAGCAGGG + Intergenic
1086052235 11:82606866-82606888 CAGTATGTACAGGAGCACAGAGG + Intergenic
1086911671 11:92479573-92479595 CCTTATCTACAGAGGCAGAATGG - Intronic
1089212340 11:116814032-116814054 CTGTATGTACAGGAAGAGAGTGG + Intergenic
1090634859 11:128684612-128684634 CAGTATCTATAAGAGCAAAGTGG - Intergenic
1097107132 12:56632515-56632537 CCGGCTCTTCCGGAGCAGAGTGG - Intronic
1099612467 12:84891642-84891664 ACGTTTCCACAGGAGCAGATGGG - Intronic
1099721750 12:86370975-86370997 CTATATGTATAGGAGCAGAGAGG + Intronic
1113124761 13:106964953-106964975 CTGGATCTTCAGGGGCAGAGGGG - Intergenic
1113329614 13:109315745-109315767 CCTTATCTACAGGTCTAGAGAGG - Intergenic
1113913622 13:113856829-113856851 CCGTCCCTGCAGAAGCAGAGAGG - Intronic
1119829801 14:77691956-77691978 TGGTATCAACAGGAGCAGTGAGG - Intronic
1124659252 15:31531956-31531978 AGGTATCAACAGGGGCAGAGGGG + Intronic
1129149447 15:73678657-73678679 GCCTATCTCCAGGAGAAGAGGGG + Intergenic
1130530725 15:84746548-84746570 CCTTAACTAAAGGAGCTGAGAGG - Intergenic
1131417858 15:92276392-92276414 GAGTAGCTCCAGGAGCAGAGTGG + Intergenic
1134809632 16:17156500-17156522 CCATAGCTGCAGGAGCAAAGTGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1143068362 17:4267525-4267547 CCGTAGCTTCAAGAGCACAGGGG + Intergenic
1150612038 17:66740950-66740972 ACGTGTCTACACGAGCAGAGAGG - Intronic
1154370623 18:13758914-13758936 TTGTATCTCCAGGAACAGAGAGG + Intronic
1157478545 18:48038271-48038293 GAGAATCTGCAGGAGCAGAGGGG - Intronic
1158969319 18:62651580-62651602 GAGAATCGACAGGAGCAGAGGGG + Intergenic
1160007102 18:75075602-75075624 CAGCATGTCCAGGAGCAGAGGGG - Intergenic
1165422801 19:35730713-35730735 CCGTCTGTACTGGAGCACAGTGG + Exonic
1166978908 19:46621414-46621436 CCTTTCCCACAGGAGCAGAGGGG + Exonic
926066560 2:9844557-9844579 CTGTATATACAGGAGCAGTACGG + Intronic
927827189 2:26317050-26317072 CTGATTCTACAGGAGCAGAGGGG + Exonic
927902270 2:26829096-26829118 CTGTCTCCACAGGAGCAGCGGGG + Intergenic
932061461 2:68503983-68504005 CAGTATCAACAGTAGAAGAGGGG + Intronic
935293104 2:101626306-101626328 CCATATCTACAAGCGGAGAGAGG - Intergenic
936559814 2:113527481-113527503 CCGTGCAGACAGGAGCAGAGGGG + Intergenic
945200435 2:207275632-207275654 CGGAAGCTACAGGAGTAGAGTGG + Intergenic
945742473 2:213680280-213680302 CCTTATCCACAGGAGCATAATGG + Intronic
946949146 2:224853621-224853643 CCGTATCTACTGATGAAGAGAGG - Intronic
1173274339 20:41566508-41566530 CCTTATCCACAGGAGCAGAGTGG - Intronic
1175365004 20:58447081-58447103 CAGTAACCACAGGAGCAGACTGG - Exonic
1175890242 20:62312775-62312797 CTGGATCTACAGGACCAGTGGGG + Exonic
1177215514 21:18123308-18123330 CCGTATCTACAGGAGCAGAGTGG - Intronic
1178335053 21:31735046-31735068 GCCTATATAGAGGAGCAGAGAGG - Intergenic
1179285904 21:39977134-39977156 CCTTCTCTGCAGGAGCAGACTGG + Intergenic
949089483 3:10980-11002 CCCTCTCTGCAGGCGCAGAGAGG + Intergenic
951530068 3:23690585-23690607 TTGTATCTCCAGGAGTAGAGAGG + Intergenic
952914420 3:38222471-38222493 CATTATCTGCAAGAGCAGAGTGG + Intronic
955385336 3:58474760-58474782 CCATATCTACAGGAACATAGTGG + Intergenic
961054523 3:123776887-123776909 CAGGATCTACAGGGGCATAGTGG - Intronic
962164388 3:133033924-133033946 CCATATGTACAGGAGGAGGGAGG + Intergenic
963084385 3:141423087-141423109 CCGTATCGTCAGGAGCTGAAGGG - Intronic
963619630 3:147589731-147589753 CAGTATCTACAGTAGAAAAGTGG - Intergenic
966875977 3:184321895-184321917 CCGTAGCTGGAGTAGCAGAGGGG - Exonic
967188414 3:186965017-186965039 CCCTCTCTACAGGGGCAGGGAGG - Intronic
969203170 4:5622131-5622153 CATGATCCACAGGAGCAGAGGGG - Intronic
971734485 4:30428753-30428775 TCATATCTAAAGGAGCAAAGTGG - Intergenic
975465583 4:74705444-74705466 CTTTATCCACAGGAGTAGAGTGG + Intergenic
975500721 4:75081340-75081362 CTTTATCCACAAGAGCAGAGTGG + Intergenic
976878535 4:89889391-89889413 CCTTATCCACAAGAGCAGAGTGG - Intronic
978972135 4:114821544-114821566 CCTTATCCACTGGAGCAGAGAGG - Intergenic
980467611 4:133205122-133205144 CCTCATCTTCTGGAGCAGAGTGG + Intronic
980561787 4:134486810-134486832 CCGTATTTAAAGAAGAAGAGTGG - Intergenic
983036728 4:162876121-162876143 ACCTATCTACCGGAGCAGGGTGG - Intergenic
987038564 5:14040883-14040905 CCTTATCTGTAGGAGCAGAGTGG + Intergenic
990518047 5:56549158-56549180 CAGTATCTGCAGAGGCAGAGTGG + Intronic
999880648 5:155860025-155860047 CTGTATTTACAGCAGGAGAGGGG - Intergenic
1007179298 6:39916922-39916944 TCACATGTACAGGAGCAGAGGGG + Intronic
1007254580 6:40519976-40519998 CAGCATATACAAGAGCAGAGTGG + Intronic
1015281991 6:131443636-131443658 CTGTCTCTCCAGGAGGAGAGTGG - Intergenic
1018931205 6:168241604-168241626 CCATTTCTACAGGAGGAAAGGGG - Intergenic
1020533441 7:9364000-9364022 CCTGGTTTACAGGAGCAGAGGGG - Intergenic
1023020828 7:36010485-36010507 CTGTAGCTACAGGAGCTGAAGGG - Intergenic
1023868921 7:44252372-44252394 AGGGATCCACAGGAGCAGAGGGG + Intronic
1024122437 7:46258158-46258180 CCATATCTAAGGGAGCAGGGAGG - Intergenic
1027455034 7:78379553-78379575 CAGTAACTACAGGAGCTGTGAGG + Intronic
1027744233 7:82053636-82053658 ACGTATCTCCAGAAGCAGAGTGG + Intronic
1027877259 7:83787032-83787054 CCTTATCCACAGGAGCAGAGTGG - Intergenic
1031302472 7:120079957-120079979 CCTTATCTGTAGGAGCAAAGTGG + Intergenic
1039200033 8:35081219-35081241 TCCTATCTACAGGAGCAATGGGG - Intergenic
1046978535 8:120311304-120311326 TAGAATCTATAGGAGCAGAGGGG - Intronic
1049443782 8:142620852-142620874 CCTTGTCCACAGGGGCAGAGTGG + Intergenic
1049893054 9:88891-88913 CCGTGCAGACAGGAGCAGAGGGG - Intergenic
1050690485 9:8222015-8222037 CCTTATCTGTGGGAGCAGAGAGG - Intergenic
1053734272 9:41088944-41088966 CCGTGCAGACAGGAGCAGAGGGG - Intergenic
1054694122 9:68342628-68342650 CCGTGCAGACAGGAGCAGAGGGG + Intronic
1057493708 9:95543198-95543220 TGGCATCTAGAGGAGCAGAGAGG + Intergenic
1057767965 9:97940201-97940223 CCGTCTCTACAGCACAAGAGGGG - Intronic
1060732270 9:126046304-126046326 CCTTATCCACAGGAGCTGAGAGG + Intergenic
1189039253 X:37525047-37525069 CCATTGCTACAGGAGCTGAGTGG - Intronic
1190558108 X:51658259-51658281 CCTTATCCATGGGAGCAGAGAGG + Intergenic
1193352211 X:80476756-80476778 CTGTATCTGCAGTAGCAGTGAGG + Intergenic
1194988411 X:100517752-100517774 CCTTATCTACAGGAGCAGAGTGG - Intergenic
1196885632 X:120242919-120242941 CCTTATTTGCAGGAGCAGAATGG - Intergenic
1198675206 X:139123891-139123913 CCTTATCTACAAGAGTAGAGTGG - Intronic
1199315056 X:146367163-146367185 CCATATCTACCTGAGCACAGGGG - Intergenic
1199529597 X:148831570-148831592 CCTTATCTGCAGCAGCAGTGGGG - Intronic