ID: 1177224379

View in Genome Browser
Species Human (GRCh38)
Location 21:18234652-18234674
Sequence GCTGATGTATGGGCACAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 223}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177224370_1177224379 15 Left 1177224370 21:18234614-18234636 CCTTTACCTTTGATTACCAGAAG 0: 1
1: 0
2: 0
3: 16
4: 154
Right 1177224379 21:18234652-18234674 GCTGATGTATGGGCACAAAGTGG 0: 1
1: 0
2: 4
3: 41
4: 223
1177224367_1177224379 20 Left 1177224367 21:18234609-18234631 CCACCCCTTTACCTTTGATTACC 0: 1
1: 0
2: 3
3: 13
4: 195
Right 1177224379 21:18234652-18234674 GCTGATGTATGGGCACAAAGTGG 0: 1
1: 0
2: 4
3: 41
4: 223
1177224374_1177224379 -1 Left 1177224374 21:18234630-18234652 CCAGAAGTGGTCCCATGAGGCTG 0: 1
1: 0
2: 0
3: 17
4: 228
Right 1177224379 21:18234652-18234674 GCTGATGTATGGGCACAAAGTGG 0: 1
1: 0
2: 4
3: 41
4: 223
1177224368_1177224379 17 Left 1177224368 21:18234612-18234634 CCCCTTTACCTTTGATTACCAGA 0: 1
1: 0
2: 2
3: 17
4: 155
Right 1177224379 21:18234652-18234674 GCTGATGTATGGGCACAAAGTGG 0: 1
1: 0
2: 4
3: 41
4: 223
1177224372_1177224379 9 Left 1177224372 21:18234620-18234642 CCTTTGATTACCAGAAGTGGTCC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1177224379 21:18234652-18234674 GCTGATGTATGGGCACAAAGTGG 0: 1
1: 0
2: 4
3: 41
4: 223
1177224369_1177224379 16 Left 1177224369 21:18234613-18234635 CCCTTTACCTTTGATTACCAGAA 0: 1
1: 0
2: 1
3: 27
4: 215
Right 1177224379 21:18234652-18234674 GCTGATGTATGGGCACAAAGTGG 0: 1
1: 0
2: 4
3: 41
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177224379 Original CRISPR GCTGATGTATGGGCACAAAG TGG Intronic
900900335 1:5511560-5511582 GGTGATGTGTGGGCACACAAGGG - Intergenic
901729251 1:11266978-11267000 GCTCAAGCATGGGCACTAAGAGG - Intergenic
902535506 1:17117611-17117633 GCTGGGGTAGGGGCACAGAGTGG - Intronic
902597294 1:17518241-17518263 GCTGGTGTCTGAGCAGAAAGTGG + Intergenic
902615531 1:17621611-17621633 CCAGATGTATGTGCACAGAGGGG + Intronic
902970079 1:20042041-20042063 GCTGTTATATGGGCTGAAAGAGG - Intronic
903395693 1:23000303-23000325 GCTGTTATATGGGCTGAAAGAGG - Intergenic
903455043 1:23481756-23481778 CCAGATGTATGGGCATAAATGGG + Intronic
904491846 1:30865490-30865512 GCTGAGTGATGGGCACATAGGGG - Intergenic
904917618 1:33981811-33981833 GCTGAGGAATGGGCACAGTGAGG + Intronic
905283664 1:36865434-36865456 ACTGACCAATGGGCACAAAGAGG + Intronic
905429574 1:37911698-37911720 GCTGTTATATGGGCAGAAAGAGG + Intronic
907168907 1:52442250-52442272 GCTGATGGATAGGGACAAAATGG + Intronic
909015029 1:70371602-70371624 CCTGTTATATGGGCAAAAAGAGG + Intronic
909729783 1:78876871-78876893 GCTGTTGTATGGGCTGAAAGAGG + Intergenic
911071466 1:93835184-93835206 GCTGTTATATGGGCTGAAAGAGG + Intronic
911147676 1:94568374-94568396 GCTGTTATATGGGCTGAAAGGGG - Intergenic
912641316 1:111348406-111348428 GCTGATTTATGAACAGAAAGAGG + Intronic
912939182 1:114030056-114030078 GCTGTTTTATGGGCTGAAAGAGG + Intergenic
913095431 1:115511690-115511712 GCTGTTATATGGGCTGAAAGAGG - Intergenic
913241335 1:116832606-116832628 GCTGATGTAAAGGAAGAAAGGGG - Intergenic
913245479 1:116866684-116866706 GCTGTTATATGGGCAAAAAGAGG + Intergenic
915327642 1:155088995-155089017 GTTGATGTATGAGCAGAAATTGG + Intergenic
916723759 1:167504683-167504705 ATTGATTTATTGGCACAAAGAGG + Intronic
917749960 1:178044169-178044191 GCTGTTATATGGGCTGAAAGAGG + Intergenic
920425707 1:205873389-205873411 GCTGTTATATGGGCTGAAAGAGG + Intergenic
920908343 1:210191690-210191712 GCTGTTATATGGGCTGAAAGAGG + Intergenic
921205432 1:212844749-212844771 GCTGTTATATGGGCTGAAAGAGG + Intronic
921224589 1:213005627-213005649 GCTGAAGTCTGCGCATAAAGAGG - Intronic
921503775 1:215940906-215940928 GCTCTTGTATGGGCACAACCAGG - Intronic
922368801 1:224889651-224889673 GCTGTTATATGGGCAGAAAGAGG + Intergenic
922845119 1:228678605-228678627 GCTGTTTTATGGGCTGAAAGAGG - Intergenic
924511688 1:244733107-244733129 GCTCAAGTATGTGCACTAAGAGG + Intergenic
924559436 1:245145410-245145432 GCTGATGGATGGACAAAATGCGG - Intergenic
1063865446 10:10360280-10360302 GCTTAAGTTTGGGCAGAAAGGGG + Intergenic
1065897065 10:30172768-30172790 GATGATGTAGTGGCACAGAGAGG + Intergenic
1066436855 10:35403639-35403661 GCTGTTATATGGGCTGAAAGAGG - Intronic
1067232996 10:44425160-44425182 GCTGATGGATGGGCCCAAGGAGG + Intergenic
1068361056 10:55975317-55975339 GCTGTTATATGGGCTGAAAGAGG + Intergenic
1068518866 10:58057302-58057324 GCTCATGTATGTGCACTAAGAGG - Intergenic
1068636936 10:59358477-59358499 GCTAATGAAGGGGAACAAAGCGG - Intronic
1070893756 10:79964215-79964237 ACTGTTATATGGGCAGAAAGAGG + Intronic
1071187560 10:83061507-83061529 GCTGTTATATGGGCTGAAAGAGG + Intergenic
1071783918 10:88878663-88878685 GCTGATGTTGGGTCACAAAATGG + Intergenic
1071822037 10:89288870-89288892 GCTGTTACATGGGCAAAAAGAGG + Intronic
1072884777 10:99263410-99263432 GCTGTTATATGGGCTGAAAGAGG + Intergenic
1073395025 10:103210472-103210494 GCTGTTATATGGGCAGAAAGAGG + Intergenic
1073438192 10:103535189-103535211 GCTGTTGTTTGGGCACTGAGGGG + Intronic
1073683801 10:105731422-105731444 GCTGTTATATGGGGAGAAAGAGG + Intergenic
1075014230 10:118898421-118898443 GCTGTTATATGGGCTGAAAGAGG + Intergenic
1078789344 11:14527036-14527058 GCTGTTATATGGGCTGAAAGAGG + Intronic
1079314359 11:19395277-19395299 GCAGATGTGTGGGCCCAATGAGG - Intronic
1080994216 11:37580543-37580565 GCTGTTATATGGGCTGAAAGAGG - Intergenic
1084436805 11:69147558-69147580 GCTGATGTCTGGTCACACACGGG + Intergenic
1085297953 11:75441515-75441537 GCAGAGGGATGGGCACACAGAGG - Intronic
1085570544 11:77554450-77554472 GCTGTTATATGGGCAGAAAGAGG + Intronic
1086133382 11:83422848-83422870 GCTGTTATATGGGCAAGAAGAGG + Intergenic
1086970532 11:93075945-93075967 GCTGCTAGATGGGCAGAAAGCGG - Intergenic
1090074699 11:123572912-123572934 GCTGAGGCAGAGGCACAAAGAGG + Intronic
1090200547 11:124852123-124852145 GTTGATTTATAGACACAAAGGGG - Intergenic
1090544423 11:127747337-127747359 GCTCCAGTATGGGCTCAAAGGGG - Intergenic
1091113931 11:132996291-132996313 GCAAATGTATGGGTGCAAAGAGG + Intronic
1091461316 12:645575-645597 TGTGAAGTAGGGGCACAAAGTGG + Intronic
1092984691 12:13834496-13834518 GCTGATATGTGGGCCCAGAGTGG - Intronic
1093079615 12:14794600-14794622 GCAGATGTATGGCCGTAAAGTGG - Exonic
1095806434 12:46325241-46325263 GCTGTTATATGGGCAGAAAGAGG - Intergenic
1096906969 12:54944912-54944934 GCTGTTATATGGGCAAAAAGAGG - Intergenic
1097592656 12:61591066-61591088 GCTGTTATATGGGCAGAAAGAGG + Intergenic
1098920238 12:76296028-76296050 GCTGTTATATGGGCTGAAAGAGG + Intergenic
1101716311 12:107316284-107316306 GCTGGAGTGTGGGCAAAAAGGGG - Intergenic
1102116452 12:110406804-110406826 GCTGTTATATGGGCTGAAAGAGG - Intergenic
1102604837 12:114060413-114060435 GCTGTTATATGGGCTGAAAGAGG + Intergenic
1107702440 13:43061563-43061585 GATGTTATATGGGCAGAAAGAGG - Intronic
1110142900 13:72152905-72152927 GCTGATGTCTGGGCAGAAATCGG - Intergenic
1110616211 13:77544926-77544948 TCTGGTGTTTGGCCACAAAGAGG + Intronic
1111350656 13:87025184-87025206 GCTGAAATAGAGGCACAAAGAGG - Intergenic
1111934661 13:94546789-94546811 GCTGAAGCATGCGCACTAAGAGG + Intergenic
1113941762 13:114022081-114022103 CATGATCTAGGGGCACAAAGTGG + Intronic
1114770795 14:25427538-25427560 GCTGTTATATGGGCTGAAAGAGG - Intergenic
1116059555 14:39904321-39904343 TCTCATTTATGGGCACATAGAGG + Intergenic
1117174478 14:53132645-53132667 GCTGTTACATGGGCAGAAAGAGG + Intronic
1118048620 14:62002401-62002423 TCTGATGCATAGGCAAAAAGAGG - Intronic
1118869666 14:69730701-69730723 GGTGATGTAGGGGCGGAAAGGGG - Intronic
1119559983 14:75582265-75582287 GCTGTTATATGGGCTGAAAGAGG - Intronic
1120758611 14:88266663-88266685 AATGCTGAATGGGCACAAAGGGG + Intronic
1121192962 14:92046072-92046094 GCTGTTATATGGGCAGAAAGAGG - Exonic
1122507968 14:102244033-102244055 GCTGTTATATGGGCTGAAAGAGG + Intronic
1123996314 15:25720229-25720251 TCTGATGTATGTGTACAATGTGG + Intronic
1125035985 15:35123887-35123909 GATGATTTATGGGCAAAAATTGG - Intergenic
1128596649 15:68957829-68957851 GCTCAAGTATGTGCACTAAGAGG + Intronic
1128998893 15:72317090-72317112 GCTGGTGTATGGGGGCAGAGTGG + Intronic
1129259705 15:74358040-74358062 GCTGTTGTATGGGCTGAAAGAGG + Intronic
1131995064 15:98125466-98125488 GCTGGTGGATGGGCACAGAATGG + Intergenic
1132020985 15:98362286-98362308 GCTGATGGATGAGAAGAAAGGGG - Intergenic
1133939046 16:10293212-10293234 GCTGTTATATAGGCAAAAAGAGG + Intergenic
1136530260 16:30863404-30863426 GCTGTTATATGGGCTGAAAGAGG + Intronic
1137055014 16:35741154-35741176 GCTGTTATATGGGCTGAAAGAGG - Intergenic
1144813966 17:18020349-18020371 GCTGATGAAGGAGCACAAACGGG + Intronic
1145102447 17:20088345-20088367 GCTGCTGAATGGGCATTAAGTGG + Intronic
1145103238 17:20094082-20094104 GCTGATGGGTGGGTACAAAATGG + Intronic
1146823376 17:36002299-36002321 GCTCAAGTATGTGCACTAAGAGG - Intergenic
1147383135 17:40067360-40067382 TCTTATGTGTGGGCTCAAAGAGG + Intronic
1149220835 17:54413926-54413948 GCTGTTATATGGGCTGAAAGAGG + Intergenic
1149329531 17:55567054-55567076 GCTGATTTATGACCACAAAATGG + Intergenic
1150862812 17:68818659-68818681 CCTGTCGTATGGGCAGAAAGTGG - Intergenic
1151244863 17:72786670-72786692 GCTTCTGTATGGGCAGGAAGTGG + Intronic
1151934762 17:77254972-77254994 GCTTATGAATTGGCACAAAGAGG - Intergenic
1152454285 17:80404162-80404184 GCTGTTATATGGGCAGAGAGAGG + Intergenic
1152776354 17:82204381-82204403 GCCGAGGTGTGGGCACAAGGTGG - Intronic
1153361458 18:4202294-4202316 GCTAAACTATGGGTACAAAGAGG + Intronic
1153881359 18:9424402-9424424 GCTGTTATATGGGCTGAAAGAGG - Intergenic
1155158644 18:23178274-23178296 GCTGCTGTAGGGGCACACAATGG - Intronic
1155506583 18:26539390-26539412 GCTGATTCAGGGGCACAGAGTGG + Intronic
1155892479 18:31286244-31286266 GCTGTTATATGGGCAGAAAGAGG - Intergenic
1156012642 18:32512482-32512504 GCAGATGTATGGCCGTAAAGTGG + Intergenic
1156302578 18:35848330-35848352 GCTGTTATATGGGCTGAAAGAGG + Intergenic
1158443636 18:57499983-57500005 GGTGATGGATGGGAACAATGTGG - Intergenic
1159929457 18:74296182-74296204 GCTGTTATATGGGCTGAAAGAGG + Intergenic
1162262583 19:9544817-9544839 CCTGTTATATGGGCAGAAAGAGG + Intergenic
1162287017 19:9746389-9746411 GCAGTTATATGGGCAGAAAGAGG + Intergenic
1166069901 19:40380937-40380959 GCTGCTGCATGGACACGAAGGGG + Exonic
1166905435 19:46105194-46105216 GCTGTTATATGGGCTGAAAGAGG - Intergenic
1167093814 19:47362693-47362715 GGTGAGGCATGGGCAGAAAGGGG + Exonic
1167901462 19:52625303-52625325 GCTGTTATATGGGCTGAAAGAGG + Intronic
1168125622 19:54280917-54280939 GCTGATGGATGGGCTGAAGGAGG - Intronic
1168185180 19:54696013-54696035 GCTGATGGATGGGCTGAAGGAGG + Intronic
1168335685 19:55596309-55596331 GCAGATGCATGGGGACAGAGAGG + Intronic
924969536 2:112815-112837 GTTGATATGTGGGCACCAAGAGG + Intergenic
925433544 2:3817326-3817348 GCTGTTATATGGGCAAAAAGAGG - Intronic
926686427 2:15701910-15701932 GCTGAAGCATGTGCACTAAGAGG - Intronic
929383893 2:41382515-41382537 ACTGTTGTATTGGCAGAAAGAGG + Intergenic
929750355 2:44705512-44705534 GCTGATATTTAGGCACAAAGGGG + Intronic
930098707 2:47586778-47586800 GCTGTTATATGGGCTGAAAGAGG - Intergenic
931475034 2:62578944-62578966 GATGATGTACATGCACAAAGGGG - Intergenic
933138241 2:78762068-78762090 GCTGTTATATGGGCAGAAAAAGG + Intergenic
933445266 2:82371793-82371815 GCTTATGAATTGGCAAAAAGAGG + Intergenic
937594682 2:123659465-123659487 GCTGTTATATGGGCTGAAAGAGG - Intergenic
937796219 2:126024201-126024223 GATGTTGCATGGGCACAGAGAGG - Intergenic
938122725 2:128645096-128645118 GCTGCTGCAAGGGCTCAAAGTGG + Intergenic
939460452 2:142491353-142491375 GCTGTTATATGGGCTGAAAGAGG - Intergenic
939755612 2:146105525-146105547 GCTCAAGTATGTGCACTAAGAGG - Intergenic
940508536 2:154585041-154585063 GCTGGTATATAGGCAGAAAGAGG - Intergenic
944251379 2:197582685-197582707 GCTGTTATATGGGCAGAAAGAGG + Intronic
946230990 2:218291345-218291367 GCTGCTTTATTGGCGCAAAGGGG - Intronic
947410061 2:229828189-229828211 GCTGGGTCATGGGCACAAAGAGG + Intronic
947598797 2:231431766-231431788 GCTGTTATATGGGCAGAAAGAGG - Intergenic
948991089 2:241554395-241554417 GCTGCTGTGTGGTCACAGAGTGG - Intergenic
1168942986 20:1729266-1729288 GCTATTATATGGGCAGAAAGAGG - Intergenic
1169235655 20:3927901-3927923 GCTGATGCTTGGTCAAAAAGTGG + Intronic
1173315852 20:41942430-41942452 GCTGAGGGATGGGGACAAACAGG + Intergenic
1174552931 20:51374612-51374634 GCTGAATTATGGCCCCAAAGAGG - Intergenic
1174665687 20:52255759-52255781 GCAGATCTATAGACACAAAGTGG + Intergenic
1175383877 20:58581897-58581919 GCTGATGAATTGGGAGAAAGTGG + Intergenic
1176011940 20:62902098-62902120 GCTGAAGCATAAGCACAAAGGGG + Intronic
1177224379 21:18234652-18234674 GCTGATGTATGGGCACAAAGTGG + Intronic
1179069940 21:38062029-38062051 GCTGATCTAACAGCACAAAGAGG + Intronic
1182014502 22:27028187-27028209 GCTGATGAATGGGCAATAGGGGG - Intergenic
1183635309 22:39058589-39058611 GCTGTTATATGGGCAGAAAGAGG - Intronic
1183746342 22:39694155-39694177 GCTGATGGATGGGGGCAGAGAGG + Intergenic
951762464 3:26161677-26161699 GCTGTTATATGGGCTGAAAGAGG - Intergenic
951894905 3:27601336-27601358 GCTGTTATATGGGCTGAAAGAGG + Intergenic
952297223 3:32072156-32072178 GCTGTTATATGGGCTGAAAGAGG + Intronic
952792139 3:37208251-37208273 GCTGTTATATGGGCTGAAAGAGG + Intergenic
953656212 3:44856817-44856839 GCTGTTATATGGGCAGAAAGAGG - Intronic
954161436 3:48725614-48725636 GCTGTTATATGGGCTGAAAGAGG - Intronic
956233227 3:67040290-67040312 GCTGTTATATAGGCAGAAAGAGG - Intergenic
957451738 3:80389067-80389089 GCTGTTATATGGGCAGGAAGAGG + Intergenic
957675031 3:83355122-83355144 GCTGTTATATGGGCAGAAAGAGG - Intergenic
957734602 3:84189463-84189485 GCTGTTATATGGGCTGAAAGAGG - Intergenic
958422288 3:93942329-93942351 GCTGTTATATGGGCAGAAAGAGG + Intronic
958676507 3:97274484-97274506 GCTGTTGTATGGGCTGAAAGAGG - Intronic
958751324 3:98195554-98195576 GCTGTTGTATGGGCAGAAAGAGG + Intronic
958929861 3:100197493-100197515 GCTCAAGCATGGGCACTAAGAGG - Intergenic
959443863 3:106412933-106412955 GCTGATGTCTGCCCACAGAGGGG - Intergenic
961712422 3:128837852-128837874 GCTGTTACATGGGCAAAAAGAGG - Intergenic
962021925 3:131510904-131510926 GCTGTTATATGGGCTGAAAGAGG - Intergenic
962523636 3:136219241-136219263 GCTGTTATATGGGCTGAAAGAGG - Intergenic
962964294 3:140339103-140339125 GCTCATGTGTGGGCTCAAGGTGG + Intronic
963450302 3:145472100-145472122 GCTAATGAATGGGAACAGAGTGG - Intergenic
963591688 3:147269159-147269181 GCTGATGTCTGTGCACAGGGAGG + Intergenic
963593911 3:147300964-147300986 GCTGATCTATGCTCAAAAAGGGG - Intergenic
963752646 3:149198791-149198813 GAAGATGTGTGAGCACAAAGAGG - Intronic
964125167 3:153228189-153228211 GCTGTTATATGGGCTGAAAGAGG - Intergenic
964460097 3:156914980-156915002 GAGGATGGATGGACACAAAGAGG - Intronic
964940635 3:162155435-162155457 GTTGTTATATGGGCAAAAAGAGG - Intergenic
965335448 3:167427174-167427196 GCTGTTATATGGGCAGAAAGAGG + Intergenic
965866516 3:173211547-173211569 GCTGATTTATGGGGAGAGAGTGG + Intergenic
969947455 4:10799105-10799127 GCTCATGCATGTGCACTAAGAGG - Intergenic
970636466 4:18015270-18015292 GATGTAGTATGTGCACAAAGAGG + Intronic
971514965 4:27474299-27474321 GCTGAAGTATGAGCTCAGAGAGG + Intergenic
972912172 4:43830984-43831006 GCTCAAGCATGGGCACCAAGAGG + Intergenic
973751404 4:54023844-54023866 GCTGTTATATGGGCTGAAAGAGG + Intronic
973827829 4:54726569-54726591 ACTGATGAATTGGTACAAAGTGG + Intronic
974170806 4:58264793-58264815 GCTCAAGTATGTGCACTAAGAGG + Intergenic
974904123 4:68035188-68035210 GCTGTTATATGGGCAGAAAGAGG + Intergenic
976739609 4:88344891-88344913 GCTGTTATATGGGCTGAAAGAGG - Intergenic
979076750 4:116280562-116280584 AATGATGTATGGACACAGAGAGG + Intergenic
980247496 4:130266729-130266751 GGTCATGTATGTTCACAAAGAGG + Intergenic
980302390 4:131011418-131011440 GCTGTTATACGGGCAAAAAGAGG + Intergenic
980716322 4:136635002-136635024 ACTCATGTCTGGGTACAAAGAGG - Intergenic
980928243 4:139159853-139159875 GCTGTTATATGGGCAGAAAGAGG - Intronic
982319152 4:154060852-154060874 GCTGTTATATGGGCTGAAAGAGG + Intergenic
984412047 4:179407568-179407590 GCTGTTATATGGGCAGAAAGAGG + Intergenic
985774180 5:1832035-1832057 GCTGTTGCAGGGGCACCAAGAGG + Intergenic
994125813 5:96168394-96168416 GCTGTTGTATAGGCAGAAAGAGG - Intergenic
994949347 5:106438342-106438364 GTTGATGTTAGGACACAAAGTGG - Intergenic
996725488 5:126670283-126670305 GCTGTTATATGGGCAGAAAGAGG - Intergenic
997157651 5:131576440-131576462 GCTGTTATATGGGCAGAAAGAGG + Intronic
998877897 5:146618934-146618956 GTAGATGTCTGAGCACAAAGTGG - Intronic
1001397715 5:171428899-171428921 GCTGATGTATGGGGAGAGGGAGG + Intronic
1005424388 6:25686109-25686131 GCTGATGAATGGACAAAATGTGG - Intronic
1005731858 6:28705363-28705385 GCTGGTTTATTGGCACAAAAAGG + Intergenic
1007300637 6:40865404-40865426 GCTGTTATATGGGCACAAAGAGG - Intergenic
1007330355 6:41101934-41101956 CCTGATGTGTGGGGAGAAAGGGG + Intergenic
1011308196 6:85952557-85952579 GCTAAGGTATGGGCACACAAAGG - Intergenic
1011975603 6:93292937-93292959 GCTGATCTGTGGGCACAAAGAGG + Intronic
1012843493 6:104360768-104360790 GATGATGTATGGACAGAAAAAGG + Intergenic
1012994110 6:105956724-105956746 GATGGTGTATGGGCACAGTGAGG - Intergenic
1014115001 6:117660861-117660883 GCTGTTATATGGGCTGAAAGAGG - Intergenic
1020957154 7:14754509-14754531 GCTGAGATATGGGAAGAAAGTGG - Intronic
1023990452 7:45125465-45125487 GCAGTTGTGTGGGCACTAAGAGG + Intergenic
1024016803 7:45324734-45324756 GCTCATGCATGTGCACTAAGAGG + Intergenic
1025796640 7:64744028-64744050 TCTCCTGTATGGGCATAAAGAGG - Intergenic
1026626847 7:72001331-72001353 GCTCGTGTATGTGCACTAAGTGG + Intronic
1027388283 7:77679979-77680001 ACTGCTGTGTGGCCACAAAGGGG + Intergenic
1028589552 7:92480914-92480936 GCTGTTATATGGGCTGAAAGAGG - Intergenic
1028926877 7:96367522-96367544 GCTGAGCTATGGGTACAAAAAGG - Intergenic
1029194725 7:98797283-98797305 GGTGATTTATGGAGACAAAGTGG - Intergenic
1031221075 7:118966114-118966136 ACTGATGTATGGGCAGTGAGAGG - Intergenic
1031550125 7:123100173-123100195 GCTGATAAATGGGCTCATAGAGG - Intergenic
1033084991 7:138333069-138333091 GCTGTTATATGGGCAAAAAGAGG + Intergenic
1033464717 7:141580122-141580144 GCTGTTATATGGGCAAAAAGAGG - Intronic
1035157765 7:156928264-156928286 GCTCAAGTATGTGCACTAAGAGG + Intergenic
1035838990 8:2789777-2789799 GCTGATATTTGGGCACAAACAGG - Intergenic
1036959405 8:13227427-13227449 GGTGAAGTATGGGCTGAAAGAGG + Intronic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1041651518 8:60307792-60307814 TCTGTTATATGGGCAGAAAGAGG - Intergenic
1043599177 8:81917862-81917884 GCTGTTGTATGGGCAAAAAGAGG + Intergenic
1044219301 8:89650218-89650240 GCAGATGTATGGCCACAAACTGG + Intergenic
1044837073 8:96306208-96306230 GGTGGTGGATGGGCACATAGGGG - Intronic
1046075155 8:109304610-109304632 GCTGTTATATGGGCTGAAAGAGG + Intronic
1048934787 8:139345821-139345843 GTTGGTGGATGGGCAGAAAGAGG + Intergenic
1049807498 8:144547568-144547590 GCTGGTGGCTTGGCACAAAGAGG + Exonic
1052326134 9:27218286-27218308 GCTGATGTCTGGGCATGAGGAGG + Intronic
1052677141 9:31641463-31641485 TCTGATATATGGACACAGAGTGG - Intergenic
1060882020 9:127123960-127123982 GATGATGTTTGGGAACAAATTGG + Intronic
1060886645 9:127159254-127159276 GGTAATGTACAGGCACAAAGAGG - Intronic
1060957344 9:127651995-127652017 GATGCTTTATGGCCACAAAGGGG - Intronic
1203778876 EBV:89603-89625 GCAGGAGTATGGGGACAAAGAGG - Intergenic
1186007994 X:5095513-5095535 GCTAAGGTATGGGGACACAGAGG + Intergenic
1188080109 X:25828505-25828527 GCTGCTGTATGGGGACAGAGTGG + Intergenic
1188200603 X:27290271-27290293 GCTGTTATATGGGCTGAAAGAGG - Intergenic
1189986062 X:46554291-46554313 GCTCAAGTATGTGCACTAAGAGG - Intergenic
1191805492 X:65131030-65131052 GCTGTTATATGGGCTGAAAGAGG - Intergenic
1191825902 X:65364312-65364334 GCTGTTATATGGGCAAAAAGAGG + Intergenic
1191870261 X:65739702-65739724 GAGGATGTATGGGAACACAGAGG - Intronic
1192454963 X:71268837-71268859 GCTGTTATATGGGCTGAAAGAGG + Intergenic
1192706448 X:73531879-73531901 GCTGTTATATGGGCTGAAAGAGG + Intergenic
1192764174 X:74125619-74125641 GCTGTTATATGGGCAGAAAGAGG - Intergenic
1193537401 X:82731249-82731271 GCTGTTATATGGGCAATAAGAGG + Intergenic
1194845742 X:98806715-98806737 GATTATGTATGTGCACCAAGGGG - Intergenic
1195326581 X:103763377-103763399 GCTGTTATAAGGGCAGAAAGAGG - Intergenic
1198309579 X:135417478-135417500 GCTGATCTATGGGTACAAAAAGG - Intergenic
1198966248 X:142230971-142230993 GCTGTTATATAGGCAGAAAGAGG + Intergenic
1199090320 X:143683731-143683753 GCACATGTGTGGGGACAAAGCGG - Intergenic
1201307202 Y:12561255-12561277 GCTGTTATATGGGCTGAAAGAGG - Intergenic
1201891475 Y:18947852-18947874 GCTGTTATATGGGCTGAAAGAGG - Intergenic
1202062312 Y:20900284-20900306 GCTGTTATATGGGCAGAAAGAGG + Intergenic
1202062741 Y:20904599-20904621 GCTGTTATATGGGCTGAAAGAGG - Intergenic