ID: 1177227804

View in Genome Browser
Species Human (GRCh38)
Location 21:18280278-18280300
Sequence AAACTTCATCCTATGAAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177227801_1177227804 19 Left 1177227801 21:18280236-18280258 CCTTCATTTGTCACTCAGATAAT No data
Right 1177227804 21:18280278-18280300 AAACTTCATCCTATGAAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177227804 Original CRISPR AAACTTCATCCTATGAAGGC CGG Intronic