ID: 1177227804 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:18280278-18280300 |
| Sequence | AAACTTCATCCTATGAAGGC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1177227801_1177227804 | 19 | Left | 1177227801 | 21:18280236-18280258 | CCTTCATTTGTCACTCAGATAAT | No data | ||
| Right | 1177227804 | 21:18280278-18280300 | AAACTTCATCCTATGAAGGCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1177227804 | Original CRISPR | AAACTTCATCCTATGAAGGC CGG | Intronic | ||