ID: 1177231708

View in Genome Browser
Species Human (GRCh38)
Location 21:18330195-18330217
Sequence TGGGGTTCAAAGGATGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177231708_1177231714 11 Left 1177231708 21:18330195-18330217 CCTCCAACATCCTTTGAACCCCA 0: 1
1: 0
2: 1
3: 20
4: 176
Right 1177231714 21:18330229-18330251 ACGTCCCTTGCCACCACAACAGG 0: 1
1: 0
2: 0
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177231708 Original CRISPR TGGGGTTCAAAGGATGTTGG AGG (reversed) Intronic
901842828 1:11964598-11964620 TGGGGGTCAGAGGCTGGTGGTGG - Intronic
903006259 1:20300923-20300945 TGGGGTTCACATGCAGTTGGTGG + Intronic
903297245 1:22351511-22351533 TGGCGTTTACAGGGTGTTGGGGG + Intergenic
907109376 1:51912862-51912884 TGGGGTTCAAACAAGTTTGGGGG + Exonic
908025692 1:59949521-59949543 TGGAGTTCAAAAAATGTTTGTGG + Intergenic
912247190 1:107971821-107971843 TTGGGGTGAAAGGAGGTTGGTGG - Intergenic
914428875 1:147601554-147601576 AGGGGGCAAAAGGATGTTGGAGG + Intronic
914808126 1:151006639-151006661 TGGTTTTCAAAGGAAGTTTGTGG + Intronic
916115892 1:161484836-161484858 TGGGGCTATAAGGATGCTGGTGG + Intergenic
917971333 1:180210031-180210053 TGGGGTCTACAGGATGATGGTGG - Intergenic
919513264 1:198493005-198493027 TGGGATACCAGGGATGTTGGTGG - Intergenic
921946335 1:220888340-220888362 TGAGGTGCAAAGGATGTCAGAGG - Intergenic
922662498 1:227442178-227442200 TGGGTTCCAAAGGATCTGGGAGG - Intergenic
923105580 1:230851164-230851186 TGGGTATCAAAAGATCTTGGGGG - Intronic
923410202 1:233700595-233700617 TGGGGTAGAAAGGAGGCTGGGGG - Intergenic
1062823956 10:555473-555495 TGGGGTTCCAAGGAGATTGGGGG - Intronic
1062971660 10:1653426-1653448 TGGGGTCCCAGGAATGTTGGGGG + Intronic
1067267324 10:44757286-44757308 TGGGGGTGAAAGGAGGATGGGGG - Intergenic
1069605163 10:69734113-69734135 TGGGGTTCAAAGTTTGCTGTTGG - Intergenic
1071466247 10:85942333-85942355 CCTGGTTCAGAGGATGTTGGTGG + Intronic
1071513613 10:86282735-86282757 GGGGGCTCAGAGGATGTGGGAGG - Intronic
1073404229 10:103283137-103283159 TGAGGTCCAATGGATGTTAGTGG + Intronic
1073509313 10:104033507-104033529 TGGAATACAAAGGAAGTTGGAGG - Intronic
1078715870 11:13838479-13838501 TGGGCCTCAAAGGATGTTGGAGG - Intergenic
1082178522 11:49089559-49089581 TGTAGTTGAAAGGATGTTGGTGG + Intergenic
1083330513 11:61896249-61896271 GGGGGGCCAAAGGAAGTTGGAGG - Intergenic
1083611565 11:64006882-64006904 AGAGGTTCAAAGGGTGCTGGTGG + Intronic
1085262207 11:75213202-75213224 TGGGGGTGGGAGGATGTTGGTGG - Intergenic
1086916061 11:92531416-92531438 TGGGGTTCCAAGGATGTGGAGGG + Intronic
1090314161 11:125770200-125770222 TGAGGTGGAAAGGATGTTGCTGG - Intergenic
1094012670 12:25825675-25825697 AGGGTTTCACAGGATGTTGCTGG - Intergenic
1095276274 12:40286556-40286578 TGGGGCTCAGAGCATGGTGGGGG - Intronic
1098195632 12:67998529-67998551 TGGGGTGCAGGGGATGATGGGGG + Intergenic
1098964677 12:76774361-76774383 CCGCTTTCAAAGGATGTTGGGGG - Intronic
1099259249 12:80355927-80355949 TGCTGTTCAAAGGAAGTTTGTGG + Exonic
1104856576 12:131905031-131905053 TGGGGTGCACAGGCTGTGGGTGG + Intronic
1105242859 13:18622949-18622971 TGGGGGTCCTAGAATGTTGGTGG + Intergenic
1108442297 13:50467153-50467175 TGTGGTTCACAGGATGATGAGGG - Intronic
1110007022 13:70285567-70285589 TGGGGTGATAAGGATGTTCGTGG + Intergenic
1114159174 14:20143963-20143985 TGTGGTTCCCAGGATGTTGGTGG + Exonic
1117495051 14:56294509-56294531 TTTGGTTCAAAGGACTTTGGCGG - Intronic
1117759669 14:59014188-59014210 TGAGGTCCAAAGGAAGTGGGTGG - Intergenic
1121454850 14:94031583-94031605 TGGCGTTCCAGGGATGTAGGAGG + Intronic
1122663775 14:103315263-103315285 TATGGTTCGAAGGATGCTGGTGG - Intergenic
1123544934 15:21330728-21330750 TGGGGGTCCTAGAATGTTGGTGG - Intergenic
1123574367 15:21652162-21652184 TGTGGCTCCCAGGATGTTGGTGG + Intergenic
1123577208 15:21683265-21683287 TGTGGCTCCCAGGATGTTGGTGG + Intergenic
1123610982 15:22094749-22094771 TGTGGCTCCCAGGATGTTGGTGG + Exonic
1124218590 15:27830212-27830234 TGGGGTTTTGAGTATGTTGGTGG - Intronic
1128604684 15:69027911-69027933 TGGGATTTAAAGGCTGATGGGGG + Intronic
1129250399 15:74305614-74305636 TGGGGGTCTGAGGAGGTTGGGGG - Intronic
1129970367 15:79773119-79773141 TTGGTATCTAAGGATGTTGGTGG - Intergenic
1130337164 15:82966211-82966233 TGGAGCTCAAAGTATGTGGGAGG + Intronic
1132009889 15:98266634-98266656 TGGGTTTGAAAGGAAGTGGGTGG + Intergenic
1202983231 15_KI270727v1_random:386505-386527 TGTGGCTCCCAGGATGTTGGTGG + Intergenic
1202986076 15_KI270727v1_random:417510-417532 TGTGGCTCCCAGGATGTTGGTGG + Intergenic
1132581231 16:685634-685656 TGGGGTTCAGAGGCGGATGGAGG - Intronic
1133092095 16:3412628-3412650 TGGAGGCCAAAGGATGTGGGTGG - Intronic
1133105143 16:3502673-3502695 TGGGGTTTGAAGGTTTTTGGTGG + Intronic
1133583837 16:7172460-7172482 TGGGGATCAAAGGGTGGTTGTGG - Intronic
1135067436 16:19322367-19322389 TGCAGTTCAAAGTCTGTTGGTGG - Intergenic
1136162455 16:28429396-28429418 TGGGGTTACAAGGAAGTTGAGGG + Intergenic
1136200511 16:28685593-28685615 TGGGGTTACAAGGAAGTTGAGGG - Intergenic
1136216856 16:28799786-28799808 TGGGGTTACAAGGAAGTTGAGGG - Intergenic
1137319374 16:47363993-47364015 TTTGGTTCAAAGGAAGTAGGTGG + Intronic
1139073793 16:63418119-63418141 TGGGGTCCAAGGGGAGTTGGTGG + Intergenic
1139940813 16:70604207-70604229 TGCTCTTCAAAGGATGCTGGTGG - Intronic
1140148243 16:72333177-72333199 TGGTGGGCACAGGATGTTGGTGG + Intergenic
1141190196 16:81819136-81819158 TGGGGTTCAGTGGAGGTTGGCGG + Intronic
1141288705 16:82697373-82697395 AGGTGATTAAAGGATGTTGGAGG - Intronic
1141998028 16:87647473-87647495 TGGGCCTCAAAGGCTGTCGGGGG - Intronic
1143574513 17:7782979-7783001 TGGAGGTCACAGGATGATGGTGG + Intronic
1143881706 17:10035057-10035079 TGGGGTGCAGAGGCTGTTGGTGG - Intronic
1147581766 17:41631065-41631087 AGGGGGTTAAAGGATGATGGGGG + Intergenic
1147671203 17:42177904-42177926 TAGGGATAGAAGGATGTTGGGGG + Intronic
1148615555 17:48997621-48997643 TGGGGTGCAAAGAAAGTTTGCGG + Exonic
1148910289 17:50938921-50938943 TGGGGTACCCAGTATGTTGGAGG - Intergenic
1149637738 17:58184231-58184253 TGCGGGTCAAGGGAGGTTGGGGG + Intergenic
1152461974 17:80446273-80446295 TCGGCTTCCAAGGCTGTTGGTGG - Intergenic
1154446075 18:14436928-14436950 TGGGGGTCCTAGAATGTTGGTGG - Intergenic
1155373911 18:25135413-25135435 TTGGGTTGGAAGGATGATGGGGG + Intronic
1158014052 18:52763419-52763441 TGGGATTCAAAGGATGCTCCTGG - Intronic
1158649901 18:59274923-59274945 TGGTGTTAGAAGGATGTTTGCGG + Intergenic
1160269480 18:77371591-77371613 TGGGGTAAAAAGGATGCTGTTGG - Intergenic
1161596850 19:5154898-5154920 TGGTGTTGAGAGGATGCTGGAGG - Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1163088010 19:14996874-14996896 TGGGGTGCAGAGCAAGTTGGAGG - Intronic
1165307884 19:35013375-35013397 TGGAGGTCAAAGGAGGTTGAAGG + Intronic
1165738859 19:38193910-38193932 TGGGGTTCACAGGAACTTCGGGG + Intronic
1168258289 19:55179104-55179126 TGGGGCTCAAAGGACGTCTGGGG - Intronic
925272877 2:2627020-2627042 TGGGACTCACTGGATGTTGGAGG + Intergenic
932735588 2:74252031-74252053 TGGGGTTCAAGGGCTCTGGGAGG + Intronic
933775764 2:85770332-85770354 TGGGGTTGAGGGGAGGTTGGTGG + Intronic
933911391 2:86943711-86943733 TGATGTTAAAAGGATATTGGCGG + Intronic
934091691 2:88556018-88556040 TGGGGGTCAAAGGATCTTTGGGG + Intergenic
934525541 2:95049465-95049487 TGGGATTCAAAGGAAGTGGGGGG + Intronic
934581405 2:95443793-95443815 TGTAGTTCAAAGGATATTGGTGG - Intergenic
934598045 2:95632921-95632943 TGTAGTTCAAAGGATATTGGTGG + Intergenic
934906588 2:98210405-98210427 GGGGGTTCATAGGATGGTGTTGG - Intronic
935817778 2:106863462-106863484 CGGGGTTCAAAATATTTTGGGGG + Intronic
935991261 2:108720746-108720768 TGATGTTAAAAGGATATTGGCGG + Intronic
936986223 2:118313572-118313594 TGGGGATCAAAGGCTGAAGGTGG + Intergenic
937056413 2:118940962-118940984 TGGGCTTAAAAGGATAATGGGGG - Intergenic
937724289 2:125143129-125143151 TGGGGTAGAAAGGATGGAGGAGG + Intergenic
940953730 2:159706174-159706196 TGAGCTGCAAAGGATGTTTGTGG + Intergenic
940996560 2:160156419-160156441 TGGGTTTCAGAGGATGCAGGAGG - Intronic
941348687 2:164403804-164403826 TGGGCTTCAGAGAATCTTGGAGG + Intergenic
945199761 2:207269626-207269648 TGGGGCTCAAAGGAGTCTGGAGG - Intergenic
946321460 2:218957060-218957082 TGGGCTTCATAGAAGGTTGGTGG - Intergenic
948382331 2:237559464-237559486 TGTGGGTCATAGGATCTTGGTGG - Intergenic
1169231281 20:3890076-3890098 GGGGATTCAAAGGATTTGGGAGG - Intronic
1169949868 20:11032111-11032133 TGGGGTATAAAGGATGCTTGAGG + Intergenic
1170900287 20:20455814-20455836 TGGTTTTCAAAAGATTTTGGGGG + Intronic
1171341856 20:24435748-24435770 TGTGGTTCAAGGCATGGTGGAGG - Intergenic
1171961579 20:31498498-31498520 TGGAGGGCAAAGGATGTTGAAGG - Intergenic
1177231708 21:18330195-18330217 TGGGGTTCAAAGGATGTTGGAGG - Intronic
1179400529 21:41078484-41078506 TGGGGTGTAAATGATGTTGAAGG + Intergenic
1179966073 21:44806651-44806673 TGGGGTTAAAAAAATGTTGTAGG + Exonic
1181132652 22:20742384-20742406 TGGGGTTCAGCTGTTGTTGGAGG - Intronic
1182506851 22:30789652-30789674 TAGGCTTCCAAGGCTGTTGGAGG + Intronic
1182947255 22:34334821-34334843 TGGGGTCCAAAGGGAGCTGGTGG + Intergenic
950015266 3:9750491-9750513 TGGGGTACAAAGGAATTTGGGGG + Intronic
951485666 3:23206574-23206596 TGGGGTTGAAGGGGTGCTGGTGG + Intronic
954449289 3:50563076-50563098 TGGGGCACAAAGAATGTGGGAGG - Intronic
955148588 3:56344646-56344668 TGGGGTTGATGGAATGTTGGGGG - Intronic
958611859 3:96436550-96436572 TGGGGTCTGGAGGATGTTGGGGG + Intergenic
963202816 3:142602047-142602069 TGTGGCTCAAAGAATGTTGGTGG - Intronic
964418024 3:156470305-156470327 TGGGGTTTAAAAAATGTTTGTGG - Intronic
968197595 3:196721677-196721699 TGGGATTCAAATGATGCAGGAGG - Intronic
970721381 4:18993282-18993304 TGGAGTACAAAGGATTTGGGGGG - Intergenic
971251206 4:24974871-24974893 AGGGGTTGAAAGGGGGTTGGGGG + Intronic
971555596 4:28010868-28010890 TGGGGTCCAAAGGGAGCTGGTGG + Intergenic
973298342 4:48552157-48552179 TGGGGTAAGAAGGATGTTGGGGG - Intronic
974003543 4:56534038-56534060 TGGGGTTCAAGGAAGGTTTGGGG - Intronic
974402344 4:61424034-61424056 TGGGGTCCAAAGGGAGTTGATGG + Intronic
976518570 4:86000460-86000482 TAAGCTACAAAGGATGTTGGGGG - Exonic
980863665 4:138529387-138529409 TGGGTCTCAGAGGATGTGGGTGG - Intergenic
981071844 4:140549058-140549080 TGTGGTTCCTAGGATGGTGGGGG - Intronic
981165004 4:141547492-141547514 GTGGGTTCAGAGGATGTGGGAGG - Intergenic
985385907 4:189448130-189448152 TGAGATTCAAAGCATGTTGTAGG - Intergenic
985816983 5:2134542-2134564 TGGGGGTCAGGGGATGTGGGAGG - Intergenic
986117802 5:4797114-4797136 TTGGGATCAATGGATGTTGAAGG - Intergenic
986833135 5:11604528-11604550 TGGGGTTCACATGTTGTGGGAGG - Intronic
992508220 5:77408496-77408518 TGGAGGTCAAAGGAAGTTGAGGG + Intronic
996218298 5:120895061-120895083 AGGGCTCCAAAGGATGTGGGTGG + Intergenic
997236493 5:132275022-132275044 TGGGGTTCGAGGGATGTAGCAGG - Intronic
998094484 5:139389582-139389604 TGGGGATCAAAGGCCGGTGGTGG + Intronic
1001591955 5:172871737-172871759 TGGGGAACAAAGAATGTTGGCGG + Intronic
1001894230 5:175364678-175364700 TGGGGTCCAAGGGGAGTTGGTGG - Intergenic
1001894452 5:175366401-175366423 TGGCCTTCAAAGTATGTTTGAGG + Intergenic
1003949600 6:11105443-11105465 TTGAGGTGAAAGGATGTTGGTGG + Exonic
1006258711 6:32851250-32851272 TGGGGTTCTAAGGAGGCTGCAGG + Intronic
1006670094 6:35724980-35725002 TGGGTTCCAAACGCTGTTGGGGG + Intronic
1008674667 6:53806862-53806884 CAGTGTTCAAAGGTTGTTGGGGG - Intronic
1009637146 6:66280788-66280810 TGGGGTTCGGAGAATGGTGGTGG - Intergenic
1014753099 6:125274409-125274431 TGAGGTCCAAAGGGAGTTGGTGG - Intronic
1015996870 6:139003966-139003988 TGGGGGTCAATGGAGGTTAGGGG + Intergenic
1018252759 6:161888684-161888706 TGATGATCAAAGGATGCTGGAGG - Intronic
1018367550 6:163137464-163137486 TGGAGTTCTGAGGATTTTGGTGG - Intronic
1021965822 7:25916820-25916842 TGGGGGTGAGTGGATGTTGGGGG - Intergenic
1023398900 7:39777200-39777222 TGGGGGCCAAGGCATGTTGGGGG - Intergenic
1023623323 7:42094068-42094090 TGGGGTTTAAAGGAAGTTTCAGG + Intronic
1026321114 7:69268346-69268368 TTGTGTCCTAAGGATGTTGGGGG - Intergenic
1030224257 7:107131068-107131090 TGGTATTCAAAGTATGTTGTGGG - Intronic
1032223866 7:130014752-130014774 TGGGGTTAAAAGGATGTCCCAGG + Intergenic
1033528596 7:142241742-142241764 TGGGATTCAAAAGGTGTTGCAGG - Intergenic
1034849131 7:154477393-154477415 TAGGGTTCAGAGTAGGTTGGAGG + Intronic
1034981881 7:155484459-155484481 TGCTGTTTAAAGGATGCTGGGGG + Intronic
1037615337 8:20514152-20514174 TGGGCTTCAAAAGATGCTGGTGG + Intergenic
1038770034 8:30469509-30469531 TGGGGTAAAAAGGAAGTTGAAGG + Intronic
1040728518 8:50412865-50412887 TGGGGTGCAAAGTGTATTGGTGG + Intronic
1041037440 8:53808669-53808691 TGGGGGTCAGAGGTTGGTGGTGG + Intronic
1041404985 8:57488328-57488350 TGGGGTCTACAGGATGGTGGAGG + Intergenic
1041685737 8:60642910-60642932 TAAGGTACAAAGGATGATGGTGG - Intergenic
1042729465 8:71915644-71915666 TGGGATTCAAGGGATATAGGTGG + Intronic
1046479903 8:114801911-114801933 TGGGGTACAAAGGACGTAGGAGG - Intergenic
1050277598 9:4016014-4016036 TGGAATTCAAAGGTTGTTTGTGG + Intronic
1051501224 9:17779777-17779799 TTGGGCTCAAAGGATGGTGGTGG - Intronic
1051870392 9:21730777-21730799 TGGGGTGCCAGGGATGGTGGTGG - Intergenic
1053484525 9:38442024-38442046 AGGGCTTCAAAGGAGGTCGGTGG + Intergenic
1057729462 9:97596238-97596260 TGGGGGCCTGAGGATGTTGGAGG - Intronic
1058177396 9:101752802-101752824 TAGGATTGAAAGGATTTTGGAGG + Intergenic
1058787543 9:108405013-108405035 TAGGATTCAAAGGATGTTTAGGG - Intergenic
1059404178 9:114089725-114089747 TTGGGTTCAAGGGAAGGTGGAGG - Intronic
1059419770 9:114183571-114183593 TAGGGTGGAAAGGATGGTGGTGG + Intronic
1062516740 9:136940675-136940697 TGGGGTACACAGGATACTGGGGG - Exonic
1203519279 Un_GL000213v1:31593-31615 TGGGGATCCTAGAATGTTGGTGG - Intergenic
1187167694 X:16820191-16820213 TGGGGTTGAAAGGGTGTTTAGGG - Exonic
1190280674 X:48927396-48927418 TGGTGTTCGAAGGGGGTTGGGGG - Intronic
1191627021 X:63280639-63280661 TGGGGTTCCATGGAAGTTGGGGG - Intergenic
1193508809 X:82373614-82373636 TGGGGTCCAAGGGGAGTTGGTGG + Intergenic
1195429817 X:104776171-104776193 TGGGGAACAAAGAATGTTGGGGG + Intronic
1197316785 X:124976424-124976446 TAAGGTTCAAAGGAAGCTGGAGG + Intergenic
1197516908 X:127443609-127443631 TGGGGTACAGAGGATGTTTGGGG - Intergenic
1197805804 X:130397492-130397514 TGGGGGTCAGAGGAAGCTGGGGG - Intergenic
1200493204 Y:3853012-3853034 TTGAGGTGAAAGGATGTTGGTGG + Intergenic
1202193048 Y:22264047-22264069 TAGGGTTCAAAGCATTGTGGTGG + Intergenic
1202606192 Y:26641654-26641676 TGGAGTGCAACGGATTTTGGTGG + Intergenic