ID: 1177232732

View in Genome Browser
Species Human (GRCh38)
Location 21:18343306-18343328
Sequence CCTATTAAAAACCATCATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177232732_1177232734 10 Left 1177232732 21:18343306-18343328 CCTCAATGATGGTTTTTAATAGG 0: 1
1: 0
2: 0
3: 24
4: 203
Right 1177232734 21:18343339-18343361 AATAAAAATAAAATACTCCAAGG 0: 1
1: 0
2: 16
3: 212
4: 2085
1177232732_1177232735 22 Left 1177232732 21:18343306-18343328 CCTCAATGATGGTTTTTAATAGG 0: 1
1: 0
2: 0
3: 24
4: 203
Right 1177232735 21:18343351-18343373 ATACTCCAAGGTAAAATGTGAGG 0: 1
1: 0
2: 0
3: 11
4: 148
1177232732_1177232737 30 Left 1177232732 21:18343306-18343328 CCTCAATGATGGTTTTTAATAGG 0: 1
1: 0
2: 0
3: 24
4: 203
Right 1177232737 21:18343359-18343381 AGGTAAAATGTGAGGTAGATTGG 0: 1
1: 0
2: 1
3: 28
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177232732 Original CRISPR CCTATTAAAAACCATCATTG AGG (reversed) Intronic
907558187 1:55363714-55363736 CCAATAGAAATCCATCATTGAGG + Intergenic
907966742 1:59338567-59338589 ACTATCAAAAACCACCATTTTGG - Intronic
909481493 1:76132198-76132220 CCTTTTAAAAAGAATGATTGGGG - Intronic
910450438 1:87338054-87338076 CCTATTAAAAGCCATCTTAAGGG + Intronic
911374695 1:97037677-97037699 CATATTAAAAACCAATGTTGTGG + Intergenic
915403468 1:155641378-155641400 CCCCTTAAAAACCCTAATTGGGG - Intergenic
915744906 1:158148402-158148424 CCTATTAAGAACTAGCATTTGGG + Intergenic
916932764 1:169596316-169596338 ATTATTAAAAATCATCCTTGAGG + Intronic
917157675 1:172021753-172021775 CCTATCAATACTCATCATTGTGG + Intronic
917835919 1:178941572-178941594 CCTGTTAAAAACCTGCAGTGGGG + Intergenic
918879388 1:190096469-190096491 AGTATTAAACACCATCATTCTGG - Intergenic
921671743 1:217932743-217932765 TCTATTAAAAACCATCACTTTGG - Intergenic
922042818 1:221913800-221913822 CCTGGTACAAACCATCATGGGGG - Intergenic
923323538 1:232859923-232859945 CCAATTAAATAGCATCTTTGGGG + Intergenic
923649901 1:235864618-235864640 CCTTTTAAAAATGATCATTCTGG - Intronic
924189217 1:241531907-241531929 CCTGTTAAAAACAATCCATGAGG + Intergenic
924366950 1:243304376-243304398 CTTATTAGAATCCTTCATTGTGG - Intronic
1062863625 10:830324-830346 CCAATTAAAACCCATCTTTCAGG + Intronic
1064101490 10:12468360-12468382 GCTTTTAAAAACCATATTTGAGG - Intronic
1064651413 10:17513566-17513588 CATATTAAAAACCATTGTTTTGG - Intergenic
1064677152 10:17772480-17772502 CCTTTTAAGAAACATCACTGCGG + Intronic
1065221518 10:23500650-23500672 CATTTTAAAAACCACAATTGGGG - Intergenic
1067767756 10:49100148-49100170 CTTATTAAAAGCCAGCTTTGAGG - Intronic
1067936470 10:50616443-50616465 GCTATTTAAAACCAGCATTAGGG + Intronic
1068173584 10:53426778-53426800 TCTATTAAAAAACATTTTTGAGG + Intergenic
1068422228 10:56808922-56808944 CCTAGAAAAAACAATTATTGGGG - Intergenic
1072279847 10:93855968-93855990 CTTAATAAAAACCCTAATTGGGG - Intergenic
1077730012 11:4720642-4720664 CTTATTAAAAACTATGATTTTGG + Intronic
1078524959 11:12093233-12093255 GCTATTAAAATCCATTATTAAGG + Intergenic
1080914820 11:36646201-36646223 GCTATTTAAAATCATCATTCTGG - Intronic
1080950868 11:37031244-37031266 CCTAATAAAAACAAGCAATGGGG - Intergenic
1085598351 11:77831182-77831204 CCAATTTCAAACCATCATTGTGG - Intronic
1087510758 11:99090084-99090106 TCTATTAAAAACAATCATCATGG - Intronic
1089212730 11:116816917-116816939 GCAATTAAAAACCTTGATTGAGG - Intergenic
1090402003 11:126454877-126454899 CCTATTTAAAAATATCCTTGGGG + Intronic
1091434619 12:462612-462634 CCTGTTAAAAACCATGAGTAAGG - Intronic
1091466562 12:689789-689811 CTTAATAAAAACCCTAATTGAGG + Intergenic
1095225665 12:39674353-39674375 CCTTTTAAAAATCATGATTTTGG + Intronic
1095564173 12:43601439-43601461 CCTATTTAAAACAATGATTTTGG - Intergenic
1097578551 12:61425359-61425381 CTTTTTAAAAATCATCTTTGTGG - Intergenic
1098710914 12:73760060-73760082 ACTATTAAAAATAATAATTGTGG - Intergenic
1099117637 12:78647476-78647498 CCTATTAGAAACCAAATTTGGGG + Intergenic
1099832830 12:87867143-87867165 CATATTAAAAACCAAGATTTGGG - Intergenic
1101544696 12:105701363-105701385 CCTATTAAAATACATAATTCAGG - Intergenic
1103298268 12:119906743-119906765 GCTTTTAAAAACCATCAGGGAGG + Intergenic
1103964310 12:124628674-124628696 CCTATTAAAGAGCATCTTGGTGG + Intergenic
1104125519 12:125842177-125842199 CCTATTAAAAACAGAAATTGGGG - Intergenic
1105061287 12:133153576-133153598 CCTATTAAAAATCATCAGGATGG + Intronic
1109166666 13:59043490-59043512 ACTATTATACACCTTCATTGAGG + Intergenic
1109455500 13:62583022-62583044 CCTCTTACAAAGCATCAGTGGGG - Intergenic
1110896935 13:80765177-80765199 CATAATAAGAAACATCATTGTGG + Intergenic
1111336692 13:86835450-86835472 CATATTGAAAACCAGCAATGAGG - Intergenic
1111499446 13:89096702-89096724 CCTCTTAAAAAGCATCATCAGGG - Intergenic
1111644279 13:91010492-91010514 CTAGTTAAAATCCATCATTGTGG - Intergenic
1111920216 13:94402487-94402509 CCTATTAAAAACAATCCTGTTGG + Intronic
1114470939 14:22961248-22961270 CCTATTTAAAACCTTAATTTGGG + Intronic
1118682996 14:68262489-68262511 CCTGTTAAAAACCTTAAGTGGGG - Intronic
1119867338 14:77984880-77984902 CCTTCTAAAAATCTTCATTGTGG + Intergenic
1121696802 14:95920233-95920255 CCTCCTGAAAACCATTATTGTGG - Intergenic
1121787062 14:96670042-96670064 CCTTTTAAAATGCATCATGGAGG + Intergenic
1123044568 14:105505056-105505078 TCTATCAAAAACCAGCAGTGGGG - Intergenic
1123802006 15:23831148-23831170 CTAATTAAAAAACATCATTTTGG + Intergenic
1124109026 15:26770257-26770279 CCTATTATAAACAAATATTGAGG - Intronic
1124199801 15:27669237-27669259 CCTATTAAAATCCATTTTTCTGG - Intergenic
1126517852 15:49556093-49556115 CTGATTAAGAACCATTATTGGGG + Intronic
1126587163 15:50300256-50300278 CCTATTAAAAAACAGAATTTGGG + Intronic
1126737838 15:51750191-51750213 CCTCTTATTAACTATCATTGGGG + Intronic
1127825947 15:62703022-62703044 CCTATTAAAAAAAATCTTTTTGG - Intronic
1129886992 15:79045481-79045503 TCTATTAAAAAGCAGCCTTGTGG + Intronic
1130967205 15:88706076-88706098 CGTATTCTAAACCATCACTGTGG - Intergenic
1131541015 15:93275416-93275438 CCCATTAATAAGCATCAGTGTGG + Intergenic
1132284556 15:100652935-100652957 CCTATAAAAGATCATCAGTGTGG + Intergenic
1133537892 16:6719744-6719766 ACTTTAAAAAACCATCATTTTGG - Intronic
1133688885 16:8194113-8194135 ACTACTAAAAAACCTCATTGCGG + Intergenic
1135199773 16:20427329-20427351 TCTACTAAAAACCACCAGTGAGG - Intronic
1135218932 16:20596281-20596303 TCTACTAAAAACCACCAGTGAGG + Intergenic
1136709455 16:32224042-32224064 CCAATAAAATACCATCATGGAGG - Intergenic
1136714869 16:32270325-32270347 ACTGTTAAAAACCATCACTGGGG - Intergenic
1136753049 16:32659411-32659433 ACTGTTAAAAACCATCACTGGGG + Intergenic
1136758455 16:32705377-32705399 CCAATAAAATACCATCATGGAGG + Intergenic
1136809653 16:33165002-33165024 CCAATAAAATACCATCATGGAGG - Intergenic
1136815064 16:33210953-33210975 ACTGTTAAAAACCATCACTGGGG - Intronic
1136816129 16:33275082-33275104 CCAATAAAATACCATCATGGAGG - Intronic
1136821540 16:33321033-33321055 ACTGTTAAAAACCATCACTGGGG - Intergenic
1136828103 16:33377572-33377594 ACTGTTAAAAACCATCACTGGGG - Intergenic
1136833169 16:33476343-33476365 ACTGTTAAAAACCATCACTGGGG - Intergenic
1139252111 16:65506413-65506435 CCCATTACACACCATCAGTGTGG - Intergenic
1140165695 16:72548402-72548424 CCTGATAAAAACCAGCAATGGGG + Intergenic
1202993641 16_KI270728v1_random:33928-33950 ACTGTTAAAAACCATCACTGGGG - Intergenic
1203055184 16_KI270728v1_random:919444-919466 ACTGTTAAAAACCATCACTGGGG + Intergenic
1203060608 16_KI270728v1_random:965707-965729 CCAATAAAATACCATCATGGAGG + Intergenic
1142824763 17:2502367-2502389 TTTATTAAAAACCATTAATGGGG + Intronic
1143790510 17:9291478-9291500 CCTATTAAATACTTCCATTGTGG + Intronic
1147333734 17:39714585-39714607 CATAATAAAAACCAACATTTAGG - Intronic
1148278526 17:46328425-46328447 CCAATTTAAAAACAGCATTGAGG + Exonic
1148300736 17:46546288-46546310 CCAATTTAAAAACAGCATTGAGG + Exonic
1149202735 17:54206798-54206820 CCTAATAAAAACAAGCAATGGGG + Intergenic
1150036899 17:61811521-61811543 CCTATTGAAAACCATCTTCTTGG - Intronic
1150401765 17:64862963-64862985 CCAATTTAAAAACAGCATTGAGG - Exonic
1155811262 18:30238770-30238792 CATTTTTAAAAACATCATTGTGG - Intergenic
1156979405 18:43266396-43266418 CCCATTAAAAAGCTTTATTGAGG + Intergenic
1158005532 18:52667960-52667982 GCTATTAAACACATTCATTGAGG + Intronic
1159701715 18:71637353-71637375 AGTATTAAAAACCAAGATTGAGG - Intergenic
1160380207 18:78448797-78448819 CCTATTAGAAACCATGATTTGGG - Intergenic
1161900872 19:7118070-7118092 CCTTTTCAAAACCATCTTTCAGG - Intronic
1166237368 19:41466273-41466295 TATATTAGAAACCATCATGGGGG + Intergenic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
1167519664 19:49946529-49946551 CTTATTACAAACCTTAATTGGGG - Intronic
925489018 2:4371003-4371025 CCTTTTAAAAATCATAACTGTGG - Intergenic
928943278 2:36749625-36749647 ACTATTAAAAAGTATCATAGTGG + Intronic
929413267 2:41721361-41721383 CATAATAAAAATTATCATTGAGG + Intergenic
929700439 2:44158197-44158219 GCTATTAATCACCATCATTCAGG - Intergenic
929753821 2:44746312-44746334 CCTATTCCAAACCCACATTGTGG + Intronic
930436373 2:51348600-51348622 CTTATTAAAAAGCATACTTGGGG - Intergenic
930648169 2:53934593-53934615 TGTATTACAAACCATCATGGCGG + Exonic
933623123 2:84567524-84567546 CCTAACAAAAACAATCAATGGGG + Intronic
935123331 2:100200789-100200811 CTTATTAAAAACTATAATTAAGG - Intergenic
935748435 2:106209828-106209850 CCGGTTAAAAACCATTAGTGTGG + Intergenic
936388546 2:112053003-112053025 TTACTTAAAAACCATCATTGGGG + Intergenic
937005607 2:118510043-118510065 CGTATTAAAGACCATAATTAGGG - Intergenic
937721983 2:125109891-125109913 AATTTTAAAAACCATCATTATGG - Intergenic
939581408 2:143952508-143952530 CTTATAAAAATCCATCATTATGG + Intronic
939921394 2:148118606-148118628 ACTATTAAAATTCATCATTTTGG + Intronic
940461811 2:153973937-153973959 CCTATTACAAATGATCATTCAGG - Intronic
940704777 2:157090570-157090592 CCTCTTAATAGCCATCATTAGGG + Intergenic
941326744 2:164124869-164124891 CCTTTTAAAAACAATAATTCTGG + Intergenic
941432603 2:165429943-165429965 CCTCTTAAAAACAAGCAATGGGG - Intergenic
942207682 2:173637419-173637441 ACTGTTAAATACCAACATTGAGG - Intergenic
944053018 2:195492811-195492833 CTCATTAAAAACCATAATTGAGG + Intergenic
947811622 2:233008150-233008172 CCTATTAAATCCCACCAATGGGG - Intronic
1169180271 20:3559563-3559585 CCAATTAAAAACCAACACTGAGG - Intronic
1170787269 20:19478483-19478505 CCTTTTAAAAACTGTCTTTGAGG - Intronic
1177232732 21:18343306-18343328 CCTATTAAAAACCATCATTGAGG - Intronic
1178087174 21:29123490-29123512 CATATTAAAAAACATTATGGAGG + Intronic
1179314398 21:40228789-40228811 CCTATTAGAAACCAAGATTTGGG + Intronic
949238403 3:1839451-1839473 CCTATCAATAGCCATGATTGTGG + Intergenic
951434582 3:22646869-22646891 ACTACTACAAACAATCATTGGGG - Intergenic
951535817 3:23739690-23739712 ATTTTTAAAAACCCTCATTGAGG + Intergenic
951567645 3:24027294-24027316 CCTTTTAATAACCACTATTGAGG + Intergenic
953629424 3:44600316-44600338 CCTAATATTAACCATCATAGTGG + Intronic
957709469 3:83836453-83836475 GCTTTTAAAAACCATAATTGAGG - Intergenic
957914342 3:86667698-86667720 ATTATATAAAACCATCATTGTGG + Intergenic
958507551 3:94999465-94999487 CCTACTAAAAACCAGCAATGGGG - Intergenic
960642955 3:119846025-119846047 CCTATCAAAAACAAGCAATGGGG + Intronic
960729265 3:120707323-120707345 CTGATTAAAACCCCTCATTGAGG - Intronic
961965336 3:130895324-130895346 CCTATTTCAAAACATCATTTAGG + Intronic
962226490 3:133615167-133615189 ACTATTAAGAACCATTATTTTGG + Intronic
962391982 3:134980037-134980059 CCTGTCAAAAACTACCATTGAGG - Intronic
962476903 3:135762918-135762940 CCTATTATATACCTTCCTTGAGG + Intergenic
966434297 3:179866216-179866238 GCTATTAACAACGGTCATTGTGG - Intronic
969060992 4:4434442-4434464 ACAATTAAAAAGCATCATAGTGG + Intronic
970330926 4:14983119-14983141 GCCATTTAAAACCATCACTGAGG + Intergenic
971165628 4:24180424-24180446 CCACTTAAAAATCATCATTCCGG + Intergenic
971558133 4:28039409-28039431 CCTAACAAAAACCAGCAATGGGG + Intergenic
971928239 4:33042834-33042856 CCTATTAAACACAATGATTGAGG - Intergenic
972493282 4:39608805-39608827 CCCATTAAAAACAATCACTCTGG + Intronic
974018919 4:56675871-56675893 CCTTTTAAAAACCATCACCTGGG - Intronic
975627275 4:76362634-76362656 CATATTAAGAACCTTCTTTGTGG + Intronic
976282979 4:83343567-83343589 CTTATTAAAAACCATTTATGAGG + Intergenic
978723643 4:111944969-111944991 CATATTAAAAACCAGCTTTTTGG - Intergenic
978859880 4:113435876-113435898 CTAATTAAGAACCATCATTAGGG + Intergenic
980606907 4:135104079-135104101 CAAATTTAAAACAATCATTGGGG - Intergenic
981619597 4:146679352-146679374 CCTGTTAAAAACAAGCAATGGGG + Intergenic
987805962 5:22769083-22769105 CCTCTTAGTAACCATCACTGGGG - Intronic
989976845 5:50597374-50597396 CCTAATAAAAACAAGCAATGGGG - Intergenic
992265888 5:75017871-75017893 CCTAATAAAAAGCATCATAGAGG + Intergenic
993348559 5:86817930-86817952 CCTTTTGAAAAACATCATGGAGG - Intergenic
995709227 5:115017990-115018012 CCTGTAAAAAACAGTCATTGTGG + Intergenic
996133641 5:119811806-119811828 CCCATTTAAAACCATCTTTACGG + Intergenic
996676171 5:126177288-126177310 CCTTTTAATAATCATCATTCTGG - Intergenic
997610200 5:135210425-135210447 GGAATTAAAAACCATCAGTGTGG + Intronic
1000368053 5:160509288-160509310 CACATTAAGAACCAACATTGGGG - Intergenic
1003208627 6:4038561-4038583 AGTATTAAAAACCCTCATTGTGG - Intronic
1004823976 6:19400488-19400510 CCTATTGAAATGCATCATTGAGG + Intergenic
1007475897 6:42119793-42119815 CCCTTTAAAAACCATCACAGTGG + Intronic
1011673341 6:89705886-89705908 CATATTTAAAATCTTCATTGGGG - Intronic
1012818623 6:104056693-104056715 CCTAACAAAAACAATCAATGGGG + Intergenic
1013200266 6:107887857-107887879 CCTGTTAAAAACAAGCAATGGGG - Intronic
1013715543 6:112956609-112956631 CCTATTTGAAACAATCAGTGAGG + Intergenic
1014902716 6:126987345-126987367 CCTGATAAAAACAATCAATGGGG + Intergenic
1015065917 6:129027342-129027364 CATATTAAAAACTATCAGTGGGG - Intronic
1015386284 6:132627709-132627731 CCTAATAAAAACAAGCAATGGGG - Intergenic
1017952488 6:159147717-159147739 CATATCATAAACCATCTTTGTGG + Intergenic
1018519685 6:164633714-164633736 CATATTAAAGTCCATCAATGTGG - Intergenic
1019600577 7:1881620-1881642 ACCATTAAACACCATCATCGAGG + Intronic
1021882167 7:25105586-25105608 CCTATTAAAAACAATAATGGTGG - Intergenic
1022621139 7:31985868-31985890 ACTTTTAAAAAACATTATTGTGG - Intronic
1023434340 7:40126725-40126747 TTCATTAAAAACCATAATTGAGG - Exonic
1027000693 7:74652013-74652035 AGTATTAAAAAATATCATTGTGG + Intergenic
1027844569 7:83355941-83355963 GCTATTAAAAGCCTGCATTGAGG + Intergenic
1028272100 7:88804304-88804326 CCTATTAAAAACTAGCATGCTGG + Intronic
1029799153 7:102927765-102927787 CCTATTCAAATCCTTCATTTTGG - Intronic
1030472383 7:109981224-109981246 TCTTTTAGAAACCATCATTGTGG + Intergenic
1031726152 7:125242042-125242064 CCTTATGAAAACCATCACTGTGG + Intergenic
1036258025 8:7220857-7220879 TCCATTAAAAACCATCAAGGTGG + Intergenic
1036310074 8:7679453-7679475 TCCATTAAAAACCATCAAGGTGG + Intergenic
1036359462 8:8066649-8066671 TCCATTAAAAACCATCAAGGTGG - Intergenic
1036891495 8:12600303-12600325 TCCATTAAAAACCATCAAGGTGG + Intergenic
1037009166 8:13819401-13819423 CCTATTAAAAGCCATGATGTGGG + Intergenic
1037647574 8:20806923-20806945 CTTCTTTAAAACCATCAGTGTGG - Intergenic
1037648032 8:20811533-20811555 CCTATTAAAGTCCATAATTTAGG + Intergenic
1038510021 8:28124814-28124836 CCTATGAAAAACCAACCTGGTGG - Intronic
1046393339 8:113606104-113606126 CATATTTAAAACCATCATGTTGG + Intronic
1048301685 8:133255914-133255936 TCTTTTAAAAATTATCATTGTGG - Intronic
1048785277 8:138043843-138043865 CCTGAGAAAAACCAGCATTGGGG - Intergenic
1049113571 8:140665988-140666010 CTTCTTATAAACCATCAATGTGG - Intronic
1052021533 9:23531129-23531151 CCTTATAGAAACCATCAGTGAGG + Intergenic
1052052271 9:23861869-23861891 CCTGACAAAAACCATCAATGGGG - Intergenic
1052463799 9:28803432-28803454 CATATTAAAAGCCATAATTGAGG + Intergenic
1053470489 9:38342821-38342843 CCTCTGAAAAACCAACATTTGGG - Intergenic
1055208276 9:73760312-73760334 AGTAGTAAAAGCCATCATTGAGG - Intergenic
1055481786 9:76715798-76715820 ATTATTTCAAACCATCATTGAGG + Intronic
1056072138 9:82998414-82998436 CCAAATGAAAACCCTCATTGTGG - Exonic
1056939786 9:90945277-90945299 CTTAATAAAAACCCTAATTGGGG + Intergenic
1058385095 9:104426965-104426987 CAAATTAAAAACCAGCTTTGTGG - Intergenic
1058574278 9:106383260-106383282 CCTATTAAGAGCAATCGTTGGGG - Intergenic
1059910939 9:119043575-119043597 CCTTTTAAAAATAATCATTTGGG + Intergenic
1059950237 9:119454746-119454768 GCTATTTAAAACCAGCCTTGTGG + Intergenic
1060491434 9:124088103-124088125 CCTGTTAAATAACATCTTTGGGG - Intergenic
1060727331 9:126015288-126015310 GCTATTAAAAAGAATGATTGAGG + Intergenic
1061829593 9:133282668-133282690 CTTAATAAAAACCCTAATTGAGG - Intergenic
1186021874 X:5265268-5265290 CGCATTAAAAAACATTATTGAGG + Intergenic
1186029939 X:5357045-5357067 CCTATTCAAAACTATATTTGAGG + Intergenic
1186624267 X:11275618-11275640 CCTTTTGAAAGCCATCATTGAGG + Intronic
1187123106 X:16428237-16428259 CCTTTCAAAAACCAGCACTGTGG - Intergenic
1192011913 X:67282733-67282755 CCTGATAAAAACAATCACTGGGG + Intergenic
1192114743 X:68399350-68399372 CCTATTTAAAACCATCTGAGGGG + Intronic
1192128538 X:68525749-68525771 CCTGATAAAAACCAGCAATGGGG - Intronic