ID: 1177233679

View in Genome Browser
Species Human (GRCh38)
Location 21:18357478-18357500
Sequence GATTATATAGAGACAATGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177233679 Original CRISPR GATTATATAGAGACAATGTA AGG (reversed) Intronic
903101846 1:21036564-21036586 ATTTATATAGAGACATGGTATGG - Intronic
903968463 1:27103818-27103840 TGTTAAATAGAGACAATGGAAGG - Intronic
906444082 1:45878589-45878611 GTTTATATAGAAAAAATCTAAGG + Intronic
907088148 1:51697830-51697852 GTTTATATGGAAACAATATAAGG - Intronic
908437052 1:64117321-64117343 GATCAAATAGAGATAATATATGG + Intronic
908481995 1:64549926-64549948 TTTTAAATAGAGGCAATGTATGG + Intronic
909791896 1:79690064-79690086 TTTTATATAGAGAAAATGAAGGG + Intergenic
910213243 1:84815555-84815577 GATTATAAAGAGGCAGTGTAAGG + Intronic
911020493 1:93382244-93382266 AATTAAACAGAGAAAATGTAGGG - Intergenic
912139650 1:106707699-106707721 GATTAGATAAAGAAAATGTGTGG - Intergenic
912708656 1:111933790-111933812 GATTAAGTACAGACAGTGTAGGG - Intronic
913160943 1:116146139-116146161 GATTATTTAGATACAGAGTATGG + Intergenic
913429257 1:118771839-118771861 GAGCAAATATAGACAATGTAAGG + Intergenic
914417847 1:147500656-147500678 GATTACATAGAGACTATAAAAGG - Intergenic
915921234 1:159977303-159977325 GATTAGAGAGAGACAAAGAATGG + Intergenic
920743954 1:208607832-208607854 GTTTAAAGAGAGAGAATGTAGGG + Intergenic
920966885 1:210708525-210708547 GTTTATATAGGGTCAATTTATGG - Intronic
922170127 1:223147124-223147146 GTTTATATGGAGACAATGGGGGG + Intergenic
922190275 1:223312764-223312786 GAGTAGAGAGAGAGAATGTAGGG - Intronic
923939096 1:238800017-238800039 GATGATATAGAGGCAATCTTGGG - Intergenic
924381460 1:243469023-243469045 GATTTTATAGAGCAAATGAAAGG + Intronic
924499062 1:244619238-244619260 GATTATAAATAGAGAATGGAAGG + Intronic
1063790119 10:9435186-9435208 GAGTATATAGAAAAAATGGATGG - Intergenic
1066519328 10:36198213-36198235 GATTATAAAAAGGCAATGCAAGG - Intergenic
1067316581 10:45171288-45171310 GATTCGATAGATACAATGTATGG + Intergenic
1078164858 11:8873449-8873471 GACTATATTTAGACAATTTAAGG - Intronic
1078831740 11:14983880-14983902 GATCATATAGAGATCATGTTAGG + Intronic
1079911580 11:26316885-26316907 GATTGTGTAAAGACAATGCAAGG - Intronic
1081195511 11:40155262-40155284 GAGTACAAAGAGACAATCTAAGG + Intronic
1083392532 11:62365095-62365117 GAATACATAGAAACAATGAATGG + Intronic
1086532739 11:87804749-87804771 GATTATATAGAAATAATTCATGG - Intergenic
1087552811 11:99673368-99673390 GATTATACAGAGTCATGGTACGG + Intronic
1087865966 11:103227268-103227290 GAGTATAAATAGACAATCTAAGG - Intronic
1088769569 11:113020188-113020210 GATTTCATAAAGGCAATGTAAGG - Intronic
1089720067 11:120409337-120409359 GAAAATATGGAGACAATGTAAGG - Intronic
1092316324 12:7418438-7418460 GAGTATAAATAGACAATCTAAGG + Intronic
1093647818 12:21608736-21608758 AATTATATAGAGACACTATGTGG - Intergenic
1093952765 12:25182449-25182471 GATTGGATAAAGAAAATGTAGGG + Intronic
1094436045 12:30422079-30422101 GGCTAAATAGAAACAATGTAAGG - Intergenic
1094760849 12:33531000-33531022 GATTAAATATGGACAATGAAAGG + Intergenic
1095900150 12:47319614-47319636 GAGTAGAGAGAGACAAAGTAAGG + Intergenic
1099049052 12:77761403-77761425 GATTAAATATAAACAATGTTGGG - Intergenic
1102327058 12:111995091-111995113 GATTTTGTAAAGACAATGCAAGG - Intronic
1105476888 13:20735758-20735780 GAGTAAATAGAGACTATGGAGGG + Intronic
1105771880 13:23619838-23619860 GATTTTATAGAGCCCATGCAGGG + Intronic
1106023262 13:25934256-25934278 GATTCACTAGAGACAATGAAAGG - Intronic
1106879260 13:34111590-34111612 TAATATATAGAGAAAATGTATGG - Intergenic
1107081405 13:36378712-36378734 GAATATATAGATATAAGGTAAGG - Intergenic
1109684429 13:65796832-65796854 GATTATAAAGAGACACAGTGTGG - Intergenic
1109761729 13:66839274-66839296 AGATATCTAGAGACAATGTAAGG - Intronic
1110538728 13:76683073-76683095 TACTATATAGAGACAATATGGGG + Intergenic
1110851682 13:80253091-80253113 ACTTATATGGAGACAATGTTCGG - Intergenic
1110894189 13:80728715-80728737 GATTATAGAGAGAAGAGGTAAGG - Intergenic
1112809545 13:103201716-103201738 GAATATAGTGAGACAATGTAAGG - Intergenic
1114233663 14:20805477-20805499 TGCTATATAGAGACAATGAAAGG + Intergenic
1114426483 14:22628192-22628214 GTTTATCTAGAGAAAATGTATGG + Intergenic
1114700003 14:24667210-24667232 CATTTTATTAAGACAATGTATGG - Intergenic
1114906265 14:27131069-27131091 AATTATATTGAGTTAATGTAAGG - Intergenic
1116036041 14:39627969-39627991 GTTTATATAGTGAAAATCTAGGG + Intergenic
1116245228 14:42403072-42403094 TATTATTTAGAGACAGAGTATGG + Intergenic
1117924781 14:60766952-60766974 GATAATATGGAGAAAATATAAGG + Intronic
1124817546 15:33010624-33010646 GATTATAAAGAGAAAAAGGAAGG + Intronic
1125321202 15:38491277-38491299 TATTATATATAGACAGTGTCTGG + Intronic
1126404154 15:48305487-48305509 TATTATTTAGAGACAAAGTCTGG + Intergenic
1126896095 15:53258480-53258502 GATTATCTACAGGCAATGTCTGG - Intergenic
1127108021 15:55637981-55638003 AATTATACAGAGAGAAAGTAAGG - Intronic
1127249126 15:57211651-57211673 GATTATAAAAATACAATTTAAGG + Intronic
1130643112 15:85698164-85698186 GATAATAAAGAGAGAATATAAGG + Intronic
1130752783 15:86730535-86730557 GCTTATTCAGATACAATGTAGGG + Intronic
1131205285 15:90440357-90440379 GGATATAAAGATACAATGTATGG - Intronic
1131572813 15:93556279-93556301 GATTAGAGAGAGAACATGTATGG - Intergenic
1133469987 16:6065729-6065751 GATGATACAGAGACACTGTCTGG - Intronic
1137033420 16:35545961-35545983 GAAAATATAAAGACAATATATGG + Intergenic
1138949199 16:61890197-61890219 GAACATAAAGAGACAATGTTAGG + Intronic
1140386201 16:74541661-74541683 GATTTTATACAGAGAATGAAAGG - Intronic
1140789845 16:78380942-78380964 GATTAGATAGAGTGAATATAAGG - Intronic
1146747097 17:35341461-35341483 GATTGTGTAAAGACAATGCAAGG + Intergenic
1150538571 17:66072910-66072932 TATTATATAAAGACAGTATAAGG + Intronic
1153378753 18:4411989-4412011 GCTTATATAGGGAGAATGTCAGG + Intronic
1153563898 18:6399745-6399767 TATCATATAGAGACCATGAAGGG - Intronic
1159670334 18:71213589-71213611 GAAAATAAAGAGACATTGTAAGG - Intergenic
1167083931 19:47296280-47296302 GATTTTATTGAGACAAGGTTTGG - Intronic
929846416 2:45533663-45533685 GATTAGACAGAGAAAAAGTAAGG + Intronic
930245865 2:48982755-48982777 AAATTTATAGAGACAATTTAAGG - Intronic
932161805 2:69466935-69466957 GATTATGTAGAAACACTGTCTGG + Intronic
935054202 2:99551675-99551697 ATTTATATAGAGACCATGAATGG - Intronic
935529262 2:104212860-104212882 GATTATATACAGACAACATAAGG - Intergenic
939378771 2:141407050-141407072 GATTATATAGAGATAATTTGAGG + Intronic
939569035 2:143818437-143818459 GATTATAATGAGACTAAGTATGG + Intergenic
940324785 2:152413631-152413653 GATAATCTAGATACAATGCAGGG + Intronic
942334019 2:174861234-174861256 GATAATATAGGTAGAATGTATGG + Intronic
943289093 2:186045418-186045440 AAATATATAGAGAAAATGTGGGG + Intergenic
945326003 2:208482985-208483007 GATTATGTAAAGACAATGCCAGG - Intronic
947097590 2:226583647-226583669 GATTATATACATGCAATGGATGG - Intergenic
947303384 2:228715368-228715390 GATTGTATAAAGACAATGCCAGG - Intergenic
1168985875 20:2048860-2048882 TATTATAGAGAGAGAATGAAGGG - Intergenic
1169487687 20:6047003-6047025 GATGTTAATGAGACAATGTAAGG - Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170085523 20:12527219-12527241 GAATATTTAAACACAATGTATGG + Intergenic
1171726138 20:28622615-28622637 TATTATATATATATAATGTATGG - Intergenic
1173410286 20:42803876-42803898 GTTTCAAGAGAGACAATGTAGGG - Intronic
1174129310 20:48330333-48330355 AATTATAAATAGACACTGTAGGG + Intergenic
1174857089 20:54056537-54056559 GATTATATAGTGGCAAAGTCTGG - Intronic
1174959311 20:55137026-55137048 TATTAAATAGAGACAATTTAAGG + Intergenic
1177233679 21:18357478-18357500 GATTATATAGAGACAATGTAAGG - Intronic
1178702983 21:34849676-34849698 GATAATATAGCCATAATGTACGG + Intronic
1182929916 22:34163260-34163282 GATTATACAAAGACAATAAATGG - Intergenic
1183511853 22:38240199-38240221 CAAGAGATAGAGACAATGTAGGG + Intronic
1183799630 22:40151081-40151103 GAGGAAACAGAGACAATGTAGGG + Intronic
1183946746 22:41330638-41330660 GATTAAAAAGAGAGAATGGATGG + Intronic
1184629788 22:45767454-45767476 AATTATATAGAAAAAATGTGTGG - Intronic
949347765 3:3092679-3092701 GATTATGGAGAGACAAGGTGAGG - Intronic
949910352 3:8899994-8900016 GATTATACAGAGAGAATTTATGG + Intronic
951965062 3:28373032-28373054 GAATAGATAAAGAAAATGTAGGG - Intronic
952121141 3:30245847-30245869 GCTTATAGAGAGACAGTGAAAGG + Intergenic
955260275 3:57382130-57382152 GAATATATACAGACAATATCTGG + Intronic
956293606 3:67688330-67688352 GATTCAATAGAGGCAGTGTAGGG + Intergenic
957375562 3:79352761-79352783 TATTATATAGATAGAATATATGG + Intronic
957979099 3:87485552-87485574 GATTGTATAAAGACAATGCCAGG + Intergenic
958659530 3:97048537-97048559 GATTAGTGAGAGACATTGTAAGG + Intronic
959768261 3:110059862-110059884 GATATCATAGAGCCAATGTAAGG - Intergenic
959857501 3:111176213-111176235 AATTAAATAGTGACACTGTAGGG + Intronic
963714994 3:148793111-148793133 AATAATATAGAGAGTATGTATGG + Intronic
963875057 3:150466266-150466288 TATTATATAGAGAGAAGGTCTGG + Exonic
963924914 3:150941234-150941256 GATTATATATATAAAATATAGGG - Intronic
964101581 3:152993745-152993767 AATTAAATAGGGGCAATGTATGG - Intergenic
966105455 3:176327357-176327379 GATTATAGAGACACACTGTCAGG - Intergenic
966519923 3:180862153-180862175 GATTGAATAAAGAAAATGTAGGG + Intronic
970736234 4:19171776-19171798 GTTTATAGAGACACAATGCATGG - Intergenic
973084360 4:46036909-46036931 ATTCATATAGAGACAATGAAAGG - Exonic
974670192 4:65020387-65020409 GATAAAATAGAGATAAAGTAAGG + Intergenic
975384600 4:73741438-73741460 GATTATTTGGAGACTATGGAAGG - Intronic
976888104 4:90010430-90010452 GAATATATATAGACAATCTAAGG + Intergenic
977654238 4:99503637-99503659 GGTTATATAGAGTCTTTGTATGG + Intergenic
978673258 4:111277251-111277273 GATTATTTAAATACAATGAAAGG + Intergenic
979163879 4:117500573-117500595 TATTATTTAGAAACAGTGTAAGG - Intergenic
980562544 4:134496821-134496843 GATTATAAAAGGACAATGTTAGG - Intergenic
980687382 4:136246121-136246143 GATTTTATAGGCACTATGTAAGG + Intergenic
981801085 4:148657280-148657302 CATAATAAAGAGAGAATGTATGG + Intergenic
982752704 4:159181530-159181552 GCTTATATTCTGACAATGTAAGG - Intronic
982831982 4:160073772-160073794 GAATATATCGGAACAATGTAAGG - Intergenic
982854733 4:160365775-160365797 GATTTTATAAAGACAATGCCAGG - Intergenic
984681640 4:182617347-182617369 GATGATATCAAGACAATGGACGG - Intronic
985259534 4:188102338-188102360 AAATATATAGAGAGAATCTATGG + Intronic
986857870 5:11892116-11892138 AAAAATATAGACACAATGTAAGG - Intronic
987978084 5:25042223-25042245 GAATATATAGAGGCCATGGAAGG - Intergenic
988774142 5:34461706-34461728 GATTGTATAAAGACAATGCCAGG - Intergenic
989788175 5:45357423-45357445 GGAAATATAGAGAAAATGTAGGG - Intronic
992450579 5:76872369-76872391 TATTTCACAGAGACAATGTAAGG + Intronic
993223499 5:85134967-85134989 GATCATTTAGAGAAAATATATGG - Intergenic
993328664 5:86570097-86570119 GATTTAATGGAGACTATGTATGG - Intergenic
993974184 5:94456518-94456540 GGTTATATAGAGGTAGTGTATGG + Intronic
994244961 5:97468267-97468289 TGTTATATAGAGCCAATGAAGGG - Intergenic
1004203162 6:13568902-13568924 GAGAAAATAGAGACAATGTAGGG + Intergenic
1004289267 6:14351538-14351560 GATTTTCTAGAGAAAATGTGGGG + Intergenic
1004525532 6:16403940-16403962 GACAATATAGAGACACTGGAGGG + Intronic
1004652363 6:17622818-17622840 CTTAATATAGAGACACTGTAAGG - Intronic
1006933755 6:37703364-37703386 GATTATATAGACACAATGCTTGG - Intergenic
1007549720 6:42719867-42719889 GATAGTATAAAGACAATTTAGGG - Intronic
1008264220 6:49404075-49404097 GACTAGATAGAGAAAATGTCGGG - Intergenic
1008657421 6:53630069-53630091 GATTAGATAAAGACCATTTAGGG + Intergenic
1008753312 6:54763222-54763244 GATTATATAAGGACAATATAAGG + Intergenic
1008982447 6:57500561-57500583 GCTTATATAGACAAAACGTAGGG + Intronic
1009170511 6:60393399-60393421 GCTTATATAGACAAAACGTAGGG + Intergenic
1009918144 6:70022805-70022827 AATGATATAGAGACAACGAATGG - Intronic
1013356769 6:109352094-109352116 AATTATTTGGAGACAATGTGAGG - Intergenic
1013880581 6:114894771-114894793 GAATATATATAGACACTGCATGG + Intergenic
1015454636 6:133412679-133412701 GATCATTCAGAGACCATGTAAGG - Intronic
1019201639 6:170321181-170321203 AATTTTATAGAGAAAATGTAAGG - Intronic
1020372084 7:7443246-7443268 GATTTTATAAAGAAAATTTATGG + Intronic
1023586249 7:41733024-41733046 GATTCAATAGAGACAAGGGAAGG - Intergenic
1024911108 7:54448444-54448466 AATTATATATAAAAAATGTATGG + Intergenic
1027588744 7:80091090-80091112 TATTATATAGACAAAATGGATGG - Intergenic
1028426304 7:90693440-90693462 CATTATAAAGACACAAGGTATGG - Intronic
1028895659 7:96039064-96039086 CATTATTTAAAAACAATGTAGGG - Intronic
1030654986 7:112157542-112157564 AATTATTTGGAGATAATGTAAGG + Intronic
1030860166 7:114615727-114615749 GAATATAAAGAGAGACTGTACGG + Intronic
1031462627 7:122070242-122070264 GATTATATAGAGAGCAACTAGGG + Intergenic
1034013473 7:147556309-147556331 GATTTTATATAAATAATGTATGG - Intronic
1040038193 8:42891592-42891614 GTTTATATAGACAAAATTTAGGG - Intronic
1041598572 8:59687515-59687537 GATTTTTTAGTGAAAATGTAAGG + Intergenic
1041633218 8:60112102-60112124 GAGTATATAGAGACATGATAAGG - Intergenic
1041677965 8:60555083-60555105 CATTATATAGATACAGTTTATGG + Intronic
1042853843 8:73244318-73244340 GATTTTAAAAAGACAATTTAGGG + Intronic
1043560607 8:81489099-81489121 TATTATATAAAGACAAAGTAGGG - Intergenic
1044247981 8:89972048-89972070 GATGATAAGGGGACAATGTAGGG + Intronic
1044461851 8:92454736-92454758 GATTATATGGAGAATAAGTAAGG + Intergenic
1045570009 8:103359120-103359142 GTTTTTATAGAGACAAGGTCTGG - Intergenic
1046321656 8:112585137-112585159 CACTCTATAGAGACAATTTAGGG - Intronic
1046445240 8:114311087-114311109 GATTATTTATAGAAAAGGTAAGG - Intergenic
1047079061 8:121439723-121439745 GATTCTATCGAGACACTGCAAGG + Intergenic
1050502119 9:6309787-6309809 GAAAAGATAAAGACAATGTAGGG - Intergenic
1051954191 9:22670043-22670065 AATTATATGGAGAAAAGGTAGGG - Intergenic
1053591643 9:39520586-39520608 AATTATAAAGAGTCAATGAATGG - Intergenic
1054166397 9:61735342-61735364 CAGTATATAGAGAAAATCTAAGG + Intergenic
1054574665 9:66844703-66844725 AATTATAAAGAGTCAATGAATGG + Intergenic
1057935503 9:99235202-99235224 GACTTTATAGAGACAAAATAGGG + Intergenic
1060670911 9:125468424-125468446 TACAATATAGAGATAATGTACGG - Intronic
1186088329 X:6015742-6015764 CATTGTATGGAGACAATATAAGG - Intronic
1186404356 X:9288905-9288927 GATTATATAGAGCCAAAATAAGG - Intergenic
1188822460 X:34792250-34792272 CATGATTTAAAGACAATGTATGG - Intergenic
1188933699 X:36147397-36147419 TATGATATAGTGACAATGAATGG + Intergenic
1189422958 X:40873190-40873212 GATTTTAGAGAAACACTGTATGG - Intergenic
1191077059 X:56466158-56466180 GAGTACAGAGAGACAATCTAAGG - Intergenic
1195384068 X:104297114-104297136 GATTATATTGTGAAAATGTCTGG + Intergenic
1196183128 X:112716930-112716952 TATTAAATAGGGGCAATGTAGGG - Intergenic
1196441649 X:115724394-115724416 GATTATAAAGAAATAATTTAAGG + Intergenic
1196445179 X:115842383-115842405 GATTATAAAGAAATAATTTAAGG + Intergenic
1198267618 X:135023934-135023956 GATTGTATAAAGACAATGCCAGG + Intergenic
1198991432 X:142519327-142519349 GATTAAATAGGGACCATGTTGGG - Intergenic
1198993537 X:142545320-142545342 GATTATTTAGAGTCACTGTGGGG + Intergenic