ID: 1177234386

View in Genome Browser
Species Human (GRCh38)
Location 21:18368135-18368157
Sequence AGGTTTTTACAGATGCTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177234386 Original CRISPR AGGTTTTTACAGATGCTTAA AGG (reversed) Intronic
901907469 1:12426402-12426424 AGTTGTTTAGAAATGCTTAAAGG - Intronic
903825342 1:26140912-26140934 AGTTTTTATCAGATTCTTAATGG + Intergenic
904411314 1:30326605-30326627 AGCATTTTACAGCTGCTGAATGG - Intergenic
907238350 1:53066817-53066839 AGATTTTTACAGATACCAAATGG + Intronic
908386228 1:63644223-63644245 AGGTGTTTGAAGATGCTGAAAGG + Intronic
909739425 1:79009676-79009698 AGGTGTTTAATGATGCTTATAGG + Intergenic
910921128 1:92348358-92348380 AGATTTTTAAAGAAGCTAAAAGG - Intronic
911420741 1:97637394-97637416 AGGTTTATTCATATGCATAAAGG - Intronic
911783957 1:101921067-101921089 AGTATTTTAAAGATGCTCAATGG + Intronic
913646426 1:120860007-120860029 AGGCTTTTAGGTATGCTTAAAGG + Intergenic
914080223 1:144402864-144402886 AGGCTTTTAGGTATGCTTAAAGG - Intergenic
914175129 1:145271396-145271418 AGGCTTTTAGGTATGCTTAAAGG - Intergenic
914529853 1:148512876-148512898 AGGCTTTTAGGTATGCTTAAAGG - Intergenic
915262988 1:154692712-154692734 AGGTTTCTACACATGCTTTTGGG - Intergenic
919426531 1:197439262-197439284 AGCTTTTATCAGCTGCTTAAAGG + Intronic
922584401 1:226722827-226722849 AGCTCTGTACAGATGCCTAATGG + Intronic
923538803 1:234873452-234873474 AGGGTTTTACGGTTACTTAATGG + Intergenic
924903417 1:248426557-248426579 AGGTTTGTTCAGATTCTTAGTGG - Intergenic
924924445 1:248665247-248665269 AGGTTTGTTCAGATTCTTAGTGG + Intergenic
1062805080 10:413245-413267 AGCTTTTTGCACATGGTTAACGG - Intronic
1062808710 10:445722-445744 AGGTGTATACAGATGCTCAGTGG - Intronic
1065537811 10:26731767-26731789 AACATTTTTCAGATGCTTAAGGG + Intronic
1066597641 10:37068936-37068958 ATGTTATTATAGATGCTTGAAGG - Intergenic
1067476271 10:46568903-46568925 AGGGTGGCACAGATGCTTAAGGG - Intergenic
1067618466 10:47772877-47772899 AGGGTGGCACAGATGCTTAAGGG + Intergenic
1068518322 10:58051196-58051218 GGGTATTTACAGATGCATAGAGG - Intergenic
1069758841 10:70793569-70793591 AGATTTTTCCAAATGCTTAGGGG + Intergenic
1070635189 10:78119921-78119943 AGGATTCTCCAGATGCTTGAAGG - Intergenic
1071181795 10:82994495-82994517 ATCTTTATACATATGCTTAATGG + Intergenic
1074630825 10:115252917-115252939 AAGTTTTTGCAGTTGCTTAATGG + Intronic
1074736306 10:116437629-116437651 AGCTTTTCAGAGATGCTTTAGGG + Intronic
1075117324 10:119637882-119637904 TGATTTTTACAGATGCAAAAGGG - Intergenic
1077871385 11:6265002-6265024 AGGTTTTGACAAATGTATAATGG + Intronic
1079113601 11:17623907-17623929 AGCTTTTTTCATATGCTTATTGG + Intronic
1079680219 11:23287154-23287176 AGCTTTTTTCATATGCTTATTGG - Intergenic
1081216621 11:40407045-40407067 AGGTTTTCATAGAAGCTTGAAGG + Intronic
1081356146 11:42116858-42116880 AGGATTGTACATATGTTTAATGG - Intergenic
1081425562 11:42922651-42922673 AGGTTTTTTCATATGTTTATTGG + Intergenic
1085892161 11:80593453-80593475 ATGTTATTATAGATGCTTGAAGG + Intergenic
1086022851 11:82252854-82252876 AGCCTTCTACACATGCTTAAAGG - Intergenic
1086109718 11:83186864-83186886 AGCTTTTATCAAATGCTTAAAGG + Exonic
1089860055 11:121582021-121582043 TAGTTTTTAAAGATGTTTAATGG + Intronic
1090312202 11:125750950-125750972 AGGTATGTACAGATGTTGAAAGG - Intergenic
1091149356 11:133312879-133312901 AGATTTATACTGATGATTAAAGG + Intronic
1092440569 12:8497770-8497792 AAGTTTTAACAGATGCTTATGGG - Intergenic
1092663747 12:10770395-10770417 AGATTTTTCCAGAAGCATAATGG - Intergenic
1093097742 12:14991142-14991164 AGCTTTTTTCATATGCTTATTGG - Intergenic
1093315658 12:17646895-17646917 GGGATGTTACAGATGCTTGAGGG + Intergenic
1093670241 12:21865653-21865675 AGGTATTTACACATGTCTAATGG - Intronic
1094367255 12:29697416-29697438 AGGCTTTCTCTGATGCTTAAGGG + Intronic
1095414660 12:41963059-41963081 AGGTTTTTCCAAATATTTAAAGG - Intergenic
1096202814 12:49697750-49697772 AGGTTTTTGAGGATGCTTACAGG - Intronic
1097623220 12:61966601-61966623 ATGTTTTAAAAGATGATTAATGG - Intronic
1098002120 12:65955856-65955878 ATGTTTTTACAGAGACTTCAAGG + Intronic
1100903541 12:99271373-99271395 ACGTTTTTACAGAATGTTAAGGG - Intronic
1102942172 12:116953036-116953058 TGGTTTTAAAAGATGCTTACAGG - Intronic
1104872560 12:132010628-132010650 AGGTTTTTAAAGATTATTAGAGG - Intronic
1106717752 13:32408638-32408660 CAGTTTTTACAGATGCGGAAAGG - Intronic
1107336141 13:39357597-39357619 AGCTTTTGACAGAGTCTTAAGGG - Intronic
1108515676 13:51200472-51200494 ACGTTTTTACAGACGCTGATTGG + Intergenic
1109048537 13:57445614-57445636 AGTTTTTAACAGATTTTTAATGG + Intergenic
1109764463 13:66875757-66875779 AGTTGTTTACAAATGCTAAAGGG + Intronic
1110244628 13:73308597-73308619 AGATTTTCTCAAATGCTTAAAGG + Intergenic
1110593974 13:77297500-77297522 AGGTTGTTCCAGATGCTGAAGGG + Intronic
1110976881 13:81848891-81848913 ATGTTTCTATATATGCTTAAAGG + Intergenic
1112113099 13:96324188-96324210 AAGTTTTTGGAGATGTTTAAAGG - Intronic
1112966680 13:105205203-105205225 AGGTTTTGACAAATGTATAATGG - Intergenic
1113328482 13:109306690-109306712 AGACTTTTCAAGATGCTTAAGGG - Intergenic
1115584833 14:34800033-34800055 AGGTTTTAAGTGATGCGTAAAGG + Intronic
1116592986 14:46803820-46803842 AGGTTTTCTAAGAAGCTTAAAGG + Intergenic
1116869974 14:50061347-50061369 AGGTGTTTACAGGGGCTGAACGG - Intergenic
1118119405 14:62821786-62821808 AGGCTTTAAGAGATGCTTGAGGG - Intronic
1119271579 14:73309977-73309999 ATGTTTTTACAATTGCTAAATGG - Intronic
1121880740 14:97498367-97498389 AGGTTTTTACTGCAGCCTAATGG - Intergenic
1122009837 14:98737032-98737054 TGGTATTTACAGAAGCTAAATGG + Intergenic
1125846476 15:42859413-42859435 GGGGTTTTACTGAAGCTTAATGG + Intronic
1126981119 15:54244262-54244284 AGGTTTTGTCAGATGGTTGAAGG + Intronic
1127160485 15:56178922-56178944 AAGTTTTTGAAGATGTTTAATGG - Intronic
1127833918 15:62774622-62774644 AGTTTTTCACAGATTCTTAGAGG - Intronic
1129892310 15:79079327-79079349 AGTTTTTGACAGAAGCTGAAGGG - Intronic
1133609528 16:7419808-7419830 TGCTTTTTCCAGATGCCTAATGG + Intronic
1135794819 16:25431743-25431765 ATGTTTTTATAGACGCTGAAAGG + Intergenic
1137011594 16:35327107-35327129 AGCTTTTTCCAGTTGCTTTATGG - Intergenic
1137018402 16:35398097-35398119 AGTTTTTTTCAGTTGCTTCATGG - Intergenic
1138041629 16:53677083-53677105 AGTTTTTGACATATGCTTACTGG - Intronic
1139591827 16:67937239-67937261 AGGTTTTTGCAGAGGAGTAAAGG - Intergenic
1140264221 16:73406638-73406660 AGTATTTTACAGATGCATATGGG - Intergenic
1140925230 16:79576044-79576066 AGGTTTTTACAGTGGGGTAAAGG - Intergenic
1141023256 16:80518405-80518427 ATGGTTTTACAGATGTTAAATGG + Intergenic
1141838352 16:86557917-86557939 GGGTTTTGACAAATGCATAATGG + Intergenic
1142548449 17:722194-722216 AGGTTATGGAAGATGCTTAAGGG - Intergenic
1144027715 17:11293145-11293167 AGGTTTTTCCAGTTGCTGTATGG + Intronic
1145101155 17:20079065-20079087 CAGTATTTAAAGATGCTTAAAGG + Intronic
1148586570 17:48785461-48785483 AGCTTTTATCAGATTCTTAAAGG + Intronic
1149653043 17:58289779-58289801 GTGATTTTACAAATGCTTAATGG + Intergenic
1153329591 18:3860175-3860197 AAGTTAATACAGATGCTGAAGGG + Intronic
1156409626 18:36815423-36815445 AGGCTTTTTCAGATTCTCAAAGG - Intronic
1159954402 18:74509127-74509149 ATTGTTTTACAGCTGCTTAAAGG + Intronic
1164438758 19:28255182-28255204 ACATTTTTACAAATGCATAAAGG - Intergenic
1166331675 19:42081357-42081379 CAGTATGTACAGATGCTTAAGGG - Exonic
1166855509 19:45781036-45781058 AGGTTTTTCCAGAGGCTGAATGG + Intronic
1167851245 19:52204042-52204064 GGGTTTTTATGGAAGCTTAATGG + Intronic
925933051 2:8726098-8726120 AGGTTTTTATTGATTTTTAAAGG + Intronic
926484370 2:13436828-13436850 AGATTTTTGGAGATGCTTACAGG + Intergenic
927560965 2:24072993-24073015 AGCTTTTATCAGATGCTCAAAGG + Intronic
928695661 2:33847444-33847466 AGGATATTACAAAGGCTTAAGGG - Intergenic
928805180 2:35141254-35141276 AGTTTTTTACAGATGATGGAAGG - Intergenic
928820054 2:35350850-35350872 CCCTTCTTACAGATGCTTAAAGG + Intergenic
929389260 2:41449896-41449918 ACTTTTTTACATATGCTTATTGG - Intergenic
929607136 2:43242135-43242157 AGGTGTTCACAGATGCTGAGGGG + Intronic
932201983 2:69836906-69836928 AGGTTTTTAAAACTGCTCAAAGG - Intronic
934485408 2:94704026-94704048 AGGTTTTTACATATGCTCGTTGG + Intergenic
935845193 2:107158457-107158479 AAGTTTTTACAATGGCTTAAAGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936952100 2:117988153-117988175 ATTTTTTTGCAGATGCTAAAAGG + Intronic
937864827 2:126742081-126742103 TGGTTTTGACAAATGCTTAATGG - Intergenic
939829798 2:147058181-147058203 AAGGTTTTAAAAATGCTTAAAGG + Intergenic
944160402 2:196653428-196653450 AGATTTCCACAGATCCTTAAGGG + Intronic
944443418 2:199765179-199765201 GGGTTTTGACAAATGCATAATGG - Intronic
945599167 2:211837011-211837033 AAGTTTTAAAAGTTGCTTAATGG - Intronic
946517944 2:220433854-220433876 AGGTTTTTACTGAAACATAATGG - Intergenic
1169393983 20:5213720-5213742 AAGTTTTTGCTGATGCTTTAGGG + Intergenic
1170131601 20:13026485-13026507 AGGTTTTTTCATATGCTTTTTGG + Intronic
1170623949 20:18016858-18016880 ATGTTTTTTCATATGATTAAGGG - Intronic
1175534774 20:59701783-59701805 GGGTTTTGACAAATGCATAATGG + Intronic
1177234386 21:18368135-18368157 AGGTTTTTACAGATGCTTAAAGG - Intronic
1179129370 21:38621014-38621036 AGGATTTCAAAGATGCTTATTGG + Intronic
1184919790 22:47597765-47597787 GGGTTTTGACAAATGCATAATGG + Intergenic
949598655 3:5575046-5575068 ACATGGTTACAGATGCTTAAGGG - Intergenic
949811472 3:8011437-8011459 TGGTTTCTACATGTGCTTAATGG + Intergenic
951823382 3:26839480-26839502 TGGTTTATACAGAAGCATAAGGG - Intergenic
953444408 3:42950470-42950492 AGCATTTTACAGATGCATACTGG + Intronic
953974583 3:47372366-47372388 ACTTTTTTACATATCCTTAATGG + Intergenic
955410401 3:58651861-58651883 AAGTTTATATAGATGCTTAGTGG - Intronic
956666399 3:71645927-71645949 AGTTTTTAACACATGCCTAAAGG + Intergenic
956730191 3:72189417-72189439 AGAGATTTACTGATGCTTAAGGG + Intergenic
958896933 3:99839797-99839819 AGGTTTTTAAAGTTGCTTTGAGG + Intronic
959158423 3:102695087-102695109 TTGTTGTTACAGATGGTTAAAGG + Intergenic
959909696 3:111750066-111750088 AAGTTTTTACAAAGGATTAAGGG + Intronic
960019083 3:112929238-112929260 CGGGTATTACAGATGCATAATGG - Exonic
960194846 3:114753093-114753115 AGGATTTTACAAATGCATCAAGG + Intronic
960698268 3:120416528-120416550 AGGTCTTAACTGATTCTTAAAGG + Intronic
960794652 3:121472815-121472837 ACATTTTTACAGATGTTTCAGGG - Intronic
964085024 3:152806803-152806825 AGGTTTTGAAAGATTCTTATAGG - Intergenic
964586654 3:158313928-158313950 AAGTTTTTACAGAACCATAAAGG + Intronic
965178563 3:165368213-165368235 TAGTTTTTACAGATGATGAATGG - Intergenic
966043632 3:175523081-175523103 AGCTTTTGACAGATTCTTAATGG + Intronic
966276822 3:178182750-178182772 ATATTTTTACAGATGCTACAGGG - Intergenic
966313485 3:178620387-178620409 ATTTTGTTACAGAAGCTTAATGG - Intronic
966469921 3:180277854-180277876 AGGTTTCCACAAATGGTTAATGG + Intergenic
966474622 3:180329775-180329797 CTGTCTTTACAGATTCTTAAAGG + Intergenic
969878247 4:10151897-10151919 GGGATTTATCAGATGCTTAAGGG + Intergenic
969938190 4:10704253-10704275 GGCATTTTACAGAAGCTTAAAGG - Intergenic
971129770 4:23794726-23794748 AAGTATTTACAGATGTTAAATGG - Exonic
971470458 4:27020075-27020097 AGGCTTTTACAACTGATTAATGG + Intronic
972808051 4:42550775-42550797 ATGTTTTTTCACATGCTTATTGG + Intronic
972970785 4:44573787-44573809 AGGTTTGTGCATATACTTAAGGG - Intergenic
974220258 4:58960078-58960100 AGGTTTCTACAGGTTTTTAAGGG - Intergenic
976015888 4:80553761-80553783 AGGTTTTTTCATATGCTTGTTGG + Intronic
976802214 4:89005675-89005697 AGCTTTTTTCATATGCTTATTGG + Intronic
977397751 4:96491934-96491956 AGCCTTTTAAAGATGATTAAAGG + Intergenic
980989207 4:139724575-139724597 AGCTTTTTGCAGACACTTAAAGG + Intronic
981044268 4:140251970-140251992 AGGTTTTTTGTGATGATTAAGGG - Intergenic
982828176 4:160026735-160026757 TGGTTTTTTCAGATTCTTAGAGG + Intergenic
983002374 4:162432867-162432889 ATGTATTTATAGATTCTTAAAGG - Intergenic
983929109 4:173433994-173434016 AGTTTATTACAGATGTTGAAAGG - Intergenic
984122120 4:175758605-175758627 CGTTTTTTATAGATGCTAAAAGG + Intronic
987006898 5:13719806-13719828 AGGTTCTTCCACATGCTAAAGGG - Intronic
989074961 5:37554874-37554896 AGATTTTTACAGGAACTTAATGG + Intronic
989182390 5:38591581-38591603 AGGTTTGTGCAGATGTTTGAAGG + Intronic
989542388 5:42632301-42632323 AGGTTTTGACTGAAACTTAAAGG - Intronic
989976633 5:50595516-50595538 AGGCTTTTAGGTATGCTTAAAGG + Intergenic
992226283 5:74622197-74622219 GGGTTTTGACAAATGTTTAATGG + Intergenic
992581389 5:78181740-78181762 ATGTTGTTATAGATGTTTAAAGG - Intronic
992905233 5:81339184-81339206 TGGTTTTTACAGAAGCCTAGGGG + Intronic
993825012 5:92673038-92673060 CCCTTTTTAAAGATGCTTAAAGG + Intergenic
994057551 5:95435428-95435450 TGGTTGTTGCAGATGCTTAGTGG + Intronic
994096812 5:95854615-95854637 TGGTTTTTACAGTGGATTAAAGG - Intronic
996361986 5:122658786-122658808 AGTTTTTAAAAGATGCTTCAGGG + Intergenic
996570575 5:124929004-124929026 AGATTTTTACAGATGGTCACTGG + Intergenic
996754207 5:126919262-126919284 AGGTTTTTACAGAAACTTGAAGG + Intronic
997032607 5:130148658-130148680 AGCTTTTTTCATATGCTTATTGG + Intronic
998254479 5:140574149-140574171 AGACTTTTACATATGCTTGATGG + Intronic
998286522 5:140867353-140867375 ATTATTTTACAGATGCGTAATGG + Intronic
998598027 5:143554695-143554717 AGGTTTCATCAGATTCTTAAAGG + Intergenic
1000759353 5:165203084-165203106 AAGTTTGTACAGATTCTTAAGGG + Intergenic
1003287160 6:4744646-4744668 AGGTTTTTAGAGATTAGTAAAGG - Intronic
1004241085 6:13923567-13923589 AGGTATTGCCAAATGCTTAATGG + Intergenic
1008403736 6:51095766-51095788 AGGTGTTTTTATATGCTTAATGG + Intergenic
1010301774 6:74268905-74268927 GGATTTTTACAGATTCTTACAGG - Intergenic
1010456453 6:76061952-76061974 AGTTTTTCACAGATACATAAAGG - Intronic
1010523566 6:76872833-76872855 AGCTTTTTTCATATGCTTATTGG + Intergenic
1011030203 6:82914354-82914376 AGCTTTTATCAGATTCTTAAAGG + Intronic
1011389607 6:86837579-86837601 AGGCTTTTACATAGGCCTAAGGG - Intergenic
1012106805 6:95171529-95171551 AGGTTTTTAAAGTTGATTAAAGG + Intergenic
1014827623 6:126064336-126064358 AGCTGTTTACAAGTGCTTAAAGG - Intergenic
1015918357 6:138241473-138241495 AGGTTTCTACATTTCCTTAAAGG - Intronic
1016487470 6:144557641-144557663 AGGTGTTTACAGATGCATCAGGG + Intronic
1017575701 6:155800273-155800295 AGGTTTTTACACAGGAATAAAGG + Intergenic
1021678298 7:23103906-23103928 AGGTTTATAAAAATGCTTAGAGG - Intergenic
1023234778 7:38073430-38073452 AGCTTTTTTCATATGCTTATTGG + Intergenic
1023723212 7:43116102-43116124 AGGTTATGTAAGATGCTTAAGGG + Intronic
1024476476 7:49817193-49817215 AGCTTTTAACAGATGAATAATGG - Intronic
1024941112 7:54764295-54764317 AGGCTTTGACAAATGCATAATGG - Intergenic
1029907900 7:104110660-104110682 AGGTTTGTAAATATGCTTCATGG - Intergenic
1030200481 7:106898142-106898164 AGCTTTTTTCATATGCTTATTGG + Intronic
1030591575 7:111488964-111488986 AGATTTTTTCATATGCTTATTGG + Intronic
1031005537 7:116466807-116466829 GGCTTTTGACAGATGCATAAGGG - Intronic
1031282591 7:119822501-119822523 AGGTTTTTACGTATGCCTCATGG + Intergenic
1033251616 7:139765439-139765461 AGCTTTTTACAAAAGCTTGAAGG - Intronic
1036928049 8:12926648-12926670 AGGATTTTAAAAATGTTTAAAGG + Intergenic
1036961617 8:13250290-13250312 AGGTCTTTGCAGAAGCTTAGTGG - Intronic
1038251003 8:25904203-25904225 AGCTTTTACCAGATTCTTAAAGG + Intronic
1038470082 8:27808300-27808322 AGGCTTCTACAGATTCTAAAGGG + Intronic
1038892637 8:31743842-31743864 ATGTTTCTACAGAAGCTTGAAGG - Intronic
1038947336 8:32375639-32375661 AGATTTTTCCAGATGTTCAAAGG - Intronic
1040032302 8:42836142-42836164 AGGCTTTTACAGATTATTCATGG - Intergenic
1040421413 8:47243382-47243404 AGGTTTCTACAGTTGCTTCAAGG - Intergenic
1043292453 8:78619898-78619920 GGGTTTTAACAAATGCATAATGG + Intergenic
1044854595 8:96462109-96462131 ACTTTATTACAGATGCTAAATGG - Intergenic
1045528799 8:102964583-102964605 GAGTTTTTACAGATGTTAAAGGG + Intronic
1045585923 8:103537268-103537290 AGGTTTCTACAAATGCTATATGG + Intronic
1046474941 8:114729951-114729973 AGGTTTTGTAAGATGCTGAAGGG - Intergenic
1047053259 8:121137175-121137197 AGGTTGTTACAAATGCATTAAGG + Intergenic
1047072307 8:121358600-121358622 AGGTTTTCCCAGATGCTGATGGG + Intergenic
1047344678 8:124015655-124015677 AAGCTTTTAAAAATGCTTAAAGG - Intronic
1047874922 8:129125531-129125553 AGGTTTTTACAGAGGCGTGAAGG - Intergenic
1052385054 9:27812749-27812771 AGGTTATTTCAGAAGTTTAAAGG + Intergenic
1052420363 9:28235284-28235306 TGGTTTTTACAGACTCTCAAAGG - Intronic
1053339045 9:37306409-37306431 AGTTATATACAGATGTTTAATGG + Intronic
1053672382 9:40380335-40380357 AGGTTTTTACATATGCTCGTTGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053922199 9:43006691-43006713 AGGTTTTTACATATGCTTGTTGG - Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054383497 9:64520364-64520386 AGGTTTTTACATATGCTCGTTGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054512242 9:65995974-65995996 AGGTTTTTACATATGCTCGTTGG + Intergenic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055412286 9:76043367-76043389 AGGTATTTACAGATATTAAAAGG + Intronic
1056071066 9:82987424-82987446 AGGTTATTTCAGCTGCATAATGG - Intronic
1057427922 9:94968720-94968742 AGGGTTTTAGAGAGGATTAAAGG + Intronic
1062148863 9:135007239-135007261 AGGTATTTACAGCTGCCAAAGGG - Intergenic
1187998963 X:24960293-24960315 AGTTTTATACAGACCCTTAAGGG + Intronic
1189157081 X:38769387-38769409 AGGCTTTTTCAGAGGCTGAAAGG + Intergenic
1192234365 X:69286324-69286346 AGGTCTTTACTGATGCTTGAAGG - Intergenic
1193434902 X:81461188-81461210 AGGTTTTTTTATATGCTTGACGG - Intergenic
1194097019 X:89653799-89653821 AGGTTTTGACAAATGCATAATGG + Intergenic
1194479914 X:94408567-94408589 AGGTATATATAGATCCTTAAAGG + Intergenic
1196055455 X:111350369-111350391 AGGCTTTTACAAATGCAAAATGG - Intronic
1196303197 X:114069706-114069728 AGGTTTTCTCATTTGCTTAAAGG + Intergenic
1197083344 X:122444593-122444615 AGGTCTTTACAAAAACTTAATGG + Intergenic
1197452152 X:126632724-126632746 GGGTATTTGCAGATGGTTAAGGG - Intergenic
1199262643 X:145793606-145793628 AGGTTTTTTCATATGCTTGTTGG - Intergenic
1199339904 X:146664890-146664912 AGTTTTTTTCATATACTTAAGGG - Intergenic
1200450039 Y:3315179-3315201 AGGTTTTGACAAATGCATAATGG + Intergenic