ID: 1177241307

View in Genome Browser
Species Human (GRCh38)
Location 21:18461719-18461741
Sequence CTATATAATTAAAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 329}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177241307 Original CRISPR CTATATAATTAAAAGGAGGA TGG (reversed) Intronic
902628584 1:17691101-17691123 CTGTCTGGTTAAAAGGAGGAGGG - Intronic
905978623 1:42202010-42202032 CTACAGAATTAAAAAGATGAAGG - Intronic
906315839 1:44786022-44786044 CTTTAAAATTAGAGGGAGGAGGG + Intronic
908216864 1:61962927-61962949 AAATATCCTTAAAAGGAGGAAGG - Intronic
908572524 1:65424350-65424372 GGATATAATTTAAAGAAGGAGGG + Intronic
909186463 1:72492563-72492585 ATAAATAAATAAAAGAAGGAAGG + Intergenic
909316338 1:74223981-74224003 CTCTATAATCAGCAGGAGGAGGG - Intronic
909570028 1:77099083-77099105 CTACATAATAAAAAACAGGAAGG + Intronic
911286855 1:96005484-96005506 ATAAATAAGTAAAAGGAAGATGG - Intergenic
911400394 1:97367551-97367573 CAATATGATTAAACGCAGGAAGG + Intronic
912617106 1:111113971-111113993 ATATATAATTGAAAGGAGGGAGG - Intergenic
913166883 1:116196065-116196087 GTTTATTATTAAAAGGAGGGAGG - Intergenic
916347062 1:163805118-163805140 TTATACAATGAAAAGCAGGAAGG + Intergenic
917710911 1:177683357-177683379 CCATATAAATGAAATGAGGAAGG + Intergenic
918257552 1:182763185-182763207 CTATGTAATCAAAATGAGCAAGG - Intergenic
920447194 1:206027216-206027238 CTATAAAATTAAAAGGAGTTTGG + Intergenic
921465650 1:215483880-215483902 CTCTCTATTTAAAAGAAGGATGG + Intergenic
921859932 1:220031903-220031925 CTATATAATTATAAAGATTAGGG + Intronic
923066078 1:230518536-230518558 CTAAACCATCAAAAGGAGGAAGG - Intergenic
923239230 1:232064231-232064253 GTATATACTTCAAATGAGGAGGG + Intergenic
924471575 1:244347238-244347260 CTATAGAATTGAAGGAAGGACGG - Intergenic
1063701254 10:8387367-8387389 CTATAGAATTAAAATGGGTAAGG + Intergenic
1064380255 10:14835600-14835622 CAATATAAATAAAAGAAGTATGG - Intronic
1064690803 10:17916772-17916794 CTATATTACTAAAAGGTTGAAGG - Intergenic
1064859485 10:19812076-19812098 CTATATTATCAAAAGGGGGTAGG - Intergenic
1065251974 10:23824285-23824307 ATAAATAAATAAAAAGAGGAGGG + Intronic
1065805833 10:29393040-29393062 CTTTATAATTAAAAGCAGGATGG - Intergenic
1068751318 10:60595793-60595815 CTTGATAATTAAAAGCAAGATGG + Intronic
1069419121 10:68231005-68231027 CTACAAAATACAAAGGAGGAGGG + Exonic
1070377867 10:75851757-75851779 CAAAATAATTAATAGGAGCATGG - Intronic
1071183226 10:83011059-83011081 CTGTATATTTAAAAAGAGTAAGG + Intergenic
1071236170 10:83651647-83651669 TGATACAATTAAAAAGAGGATGG + Intergenic
1071519097 10:86318039-86318061 CTATATAAGTCAAAGGATGCAGG - Intronic
1072044490 10:91641275-91641297 CTATTAAATTAAAAAGAAGACGG + Intergenic
1072123588 10:92425961-92425983 ATATATAAATAAATGGAGAATGG - Intergenic
1072302623 10:94076208-94076230 CTAAATAAATAAAAGGGGTACGG + Intronic
1073972207 10:109057445-109057467 CAATTTAATTAAAAGGAATACGG + Intergenic
1074103582 10:110373033-110373055 CCATATAAAGTAAAGGAGGAAGG + Intergenic
1074399904 10:113133411-113133433 CTCTATCCTCAAAAGGAGGATGG - Intronic
1075111291 10:119587033-119587055 ATAAATAATTAAAGGCAGGAAGG + Intronic
1077450678 11:2642006-2642028 CTATAGCATTAAAAGCAGCATGG - Intronic
1078012583 11:7584366-7584388 ATATATAATTGAGGGGAGGAGGG + Intronic
1080183769 11:29454828-29454850 CTATATAAAGGAAAAGAGGAAGG + Intergenic
1080525334 11:33110932-33110954 CTATAAAAATAAAAGCAGGCCGG + Intronic
1081291640 11:41333572-41333594 CTACATATTTAAAGGGAGGAGGG - Intronic
1083908413 11:65689727-65689749 ATAAATAAATAAAAAGAGGAAGG + Intergenic
1085236595 11:75020192-75020214 CTGTAAAATTAAAAGCAGGTTGG - Intergenic
1086042776 11:82498936-82498958 CTATAGAAATAAAAAGTGGAAGG + Intergenic
1087919660 11:103851914-103851936 CTATCAAGTTAAAAGGAGAAGGG - Intergenic
1088436402 11:109818072-109818094 TTATTTATTTAAAAGGAGGTGGG + Intergenic
1088476844 11:110249580-110249602 CTAGATTATTAAATGGTGGAAGG - Intronic
1088773414 11:113058331-113058353 CTATAAAATATAAAGGAGAAGGG + Intronic
1089006407 11:115095023-115095045 CTATATACTGAAAAGGTGAATGG - Intergenic
1089847443 11:121469401-121469423 CGATAAAATAAAAATGAGGAAGG - Intronic
1092252961 12:6911420-6911442 CTAGATCATTAACAGGAAGATGG - Intronic
1093019390 12:14189000-14189022 ATACATAATAAAATGGAGGAAGG + Intergenic
1093068104 12:14679970-14679992 CTATAAAATTAAAAGAATGATGG - Intronic
1094229771 12:28089680-28089702 CTATCAAATTACAAAGAGGAAGG + Intergenic
1094565259 12:31592630-31592652 CTATAAAAATAAAATGAGGCCGG + Intergenic
1095657697 12:44689639-44689661 CTAAATAAAGAAAAGGAGCATGG - Intronic
1097351691 12:58556027-58556049 CTATGAAAGTTAAAGGAGGAAGG + Intronic
1098283841 12:68888277-68888299 CAATATTATTTAAAGAAGGAGGG + Intronic
1098351615 12:69568016-69568038 CAATATATGAAAAAGGAGGAGGG - Intronic
1098746889 12:74249239-74249261 TTAAATAATAAGAAGGAGGAAGG - Intergenic
1098952609 12:76657292-76657314 CTATATAATTACAATAAGAAAGG + Intergenic
1099991763 12:89729871-89729893 CTAAATAATTCTAAGTAGGAAGG + Intergenic
1100763903 12:97842035-97842057 CTTTCTAATTAGAAAGAGGAAGG + Intergenic
1100784635 12:98065910-98065932 CCTTATAAGTAAAAGTAGGAAGG + Intergenic
1102202338 12:111066260-111066282 CTATATATTTAAAGGGATGCTGG + Intronic
1104098624 12:125584861-125584883 CTTAATAATTTAAAGGAGGAAGG - Intronic
1107752037 13:43577980-43578002 CTATATAAAAAAAAGGAGAATGG + Intronic
1107793474 13:44026435-44026457 TTATGTCATTATAAGGAGGAAGG + Intergenic
1108822712 13:54373303-54373325 ATATATATTTTAAAGCAGGAAGG + Intergenic
1109740006 13:66541104-66541126 ATTTATAGTTAGAAGGAGGAAGG - Intronic
1110066893 13:71119487-71119509 CTGTTTAATTAAAAGAAAGAAGG - Intergenic
1110958148 13:81582741-81582763 CTATATGTTTGAAAGAAGGAAGG - Intergenic
1111263785 13:85779130-85779152 CTATAAAGATAAAAGGAGGTTGG - Intergenic
1111756730 13:92406208-92406230 GTATATAATTAAGATGAAGAAGG + Intronic
1114783506 14:25567889-25567911 GCAAATAATGAAAAGGAGGAAGG - Intergenic
1114945918 14:27680190-27680212 ATATATTAATAAAATGAGGAGGG - Intergenic
1115470351 14:33762424-33762446 CTTTAAAATAAAAAGGGGGAGGG + Intronic
1116354182 14:43906508-43906530 CTATCTGATTTCAAGGAGGAAGG + Intergenic
1120465484 14:84851546-84851568 CCATGTAATTGAAAGGATGATGG + Intergenic
1120673988 14:87397482-87397504 CCACAGAATTAGAAGGAGGAAGG - Intergenic
1123001598 14:105298234-105298256 CTCTAAAATTAAAAAGAGAAAGG + Intronic
1124176681 15:27432266-27432288 CTATATAATTAATAGCACGAAGG - Intronic
1124419101 15:29503601-29503623 CTCAATAATTAAAAGAAGTAAGG + Intronic
1124967850 15:34450635-34450657 CTTTATGATTTTAAGGAGGATGG + Intergenic
1126558930 15:50022342-50022364 CAATATAATGTATAGGAGGATGG - Intronic
1126623057 15:50659260-50659282 CTATATATTTTAAAGGGGGAAGG + Intronic
1126713678 15:51489723-51489745 CAACACAATTAAAAGGGGGAAGG - Intronic
1127203640 15:56687993-56688015 TTATATAAGGAAAAGAAGGAAGG - Intronic
1127264592 15:57351294-57351316 GTATATAGATCAAAGGAGGAAGG + Intergenic
1127508841 15:59620526-59620548 CAATATAAACAAAATGAGGATGG - Exonic
1131738305 15:95358285-95358307 ATAGATAATTAAATGTAGGAAGG + Intergenic
1133417395 16:5616928-5616950 CTATTTAATTAAAAGAAAGCTGG - Intergenic
1135122314 16:19776853-19776875 CTATATACTACAAAAGAGGATGG - Intronic
1135192089 16:20362701-20362723 ATATATGATTAAAAGAAGGAGGG - Intronic
1137329855 16:47482446-47482468 CTGTATAATTAAAATGAATATGG - Intronic
1140428319 16:74880061-74880083 GTATATCATGATAAGGAGGAAGG - Intronic
1141052033 16:80776548-80776570 ATATATAAATAAAAGATGGATGG - Intronic
1141202671 16:81909985-81910007 TTATATATATAAAAGGGGGATGG + Intronic
1145405978 17:22594576-22594598 ATTTATATTTAAAAGGAGGATGG + Intergenic
1146353705 17:32117024-32117046 GTATATAATTAAAAGAATGCAGG - Intergenic
1146749572 17:35366095-35366117 CTTTTTAATTTGAAGGAGGATGG - Intronic
1148844354 17:50520206-50520228 CTATATTACTAAAATGAGGGCGG + Intronic
1149267335 17:54941292-54941314 TTCTATATTTAAAAGGGGGAGGG + Intronic
1149874369 17:60216227-60216249 CTACATACTTCAAAAGAGGAGGG + Intronic
1150088155 17:62293481-62293503 CTACATACTTCAAAAGAGGAGGG + Intergenic
1150540957 17:66098789-66098811 CTACATCATAAAAAGGAGAAAGG + Intronic
1150808176 17:68335586-68335608 GTATATAATTACATGGAGAAGGG + Intronic
1152673083 17:81620666-81620688 TTTAATAATTAAAAAGAGGAGGG + Intronic
1153475094 18:5490276-5490298 CTATAAAATTATAATTAGGAAGG - Intronic
1153482306 18:5559267-5559289 CTTTACAAATAAATGGAGGAGGG + Intronic
1155925904 18:31654985-31655007 CTCTATTATTCAAAGAAGGAGGG + Intronic
1156400487 18:36735097-36735119 CTATAAAATTAAGAGAAGAAAGG - Intronic
1156533753 18:37843276-37843298 CAATATAATTGAAAGGATGGTGG - Intergenic
1156667980 18:39431551-39431573 ATATATATTTTAAAGGATGAAGG + Intergenic
1157523996 18:48364839-48364861 TTATATAATTAAACGGAAAAAGG - Intronic
1159196763 18:65125812-65125834 CTTGATAATTAGAAGGGGGAAGG - Intergenic
1160195864 18:76754925-76754947 TTTTCTAATTAAAATGAGGATGG + Intergenic
1160215803 18:76929327-76929349 ATATAATTTTAAAAGGAGGAAGG - Intronic
1161874961 19:6901240-6901262 TTACATTATTACAAGGAGGAGGG + Intronic
1162504297 19:11073797-11073819 CAAAATAATTGAAAGCAGGATGG + Intergenic
1163090422 19:15015696-15015718 CTATATAAATGAATGAAGGAAGG + Intronic
1164345978 19:27257604-27257626 CTAAATAATTAAAAGAAGTAAGG + Intergenic
1165954243 19:39492010-39492032 CTATTTAATTAAAAGTAGTTGGG - Intronic
1166620262 19:44291596-44291618 ATATATTATTAAAAGGATAAGGG + Intronic
1166805143 19:45482104-45482126 CTATCTAATTAAAACAAAGAGGG - Intergenic
1167421807 19:49408415-49408437 CAAGACAATTAAAAGAAGGAAGG - Intronic
1167725467 19:51209864-51209886 CCTTATATTTAAAAAGAGGATGG + Intergenic
925225857 2:2183724-2183746 AGATATAACTAAAAGAAGGAAGG + Intronic
925618597 2:5768314-5768336 CAATAGAATTAGAAAGAGGAGGG - Intergenic
926903471 2:17783574-17783596 CTGTATACTTAAAATCAGGAAGG - Exonic
926915168 2:17884297-17884319 ATATATATTTAAAAAGAAGAGGG + Intronic
927017347 2:18978980-18979002 ATAAATAAATAAAAGGAGGAGGG - Intergenic
927839007 2:26425429-26425451 ATGTATACTTAAAAGCAGGATGG + Intronic
927900665 2:26816033-26816055 CTATATTATTAAAGGAAGCATGG + Intergenic
930114412 2:47706563-47706585 CTATATAATTAAAGTGGGGAAGG - Intronic
930326628 2:49928146-49928168 CTATATATTTAAGATCAGGAGGG + Intronic
932123665 2:69124358-69124380 CTCTAAACTTTAAAGGAGGATGG + Intronic
932482378 2:72052903-72052925 CTATAAAAATAAAAAGAGTATGG - Intergenic
935466153 2:103400409-103400431 CTATATGCTTAAAAGGAAGATGG + Intergenic
935923457 2:108040591-108040613 CTATAGAATGAATAGGTGGAAGG + Intergenic
935948600 2:108308474-108308496 AAATAAAATTAAAAGGTGGATGG + Exonic
937530876 2:122825576-122825598 CTACAAAATTAGAATGAGGATGG - Intergenic
939527385 2:143314000-143314022 CAATAAAATTACAAGGAGGCTGG - Intronic
939655024 2:144813742-144813764 CTCCATATTTAAAAGGAGGTGGG - Intergenic
939669908 2:144997708-144997730 TTATTTAATGACAAGGAGGAAGG - Intergenic
939698335 2:145356758-145356780 TTATATAAATAAAAGTTGGAGGG - Intergenic
940717180 2:157239252-157239274 ATTTATAATTAGAAGGAGCAAGG - Intergenic
941180740 2:162256182-162256204 CTATATAATCACAAGGTAGAGGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942403538 2:175628950-175628972 CTTTATAAGTAAAAGGATAAAGG - Intergenic
943025395 2:182621767-182621789 CTATATAATTAAGTGAATGACGG + Intergenic
943111017 2:183606068-183606090 CTTGATTATTAAAAAGAGGAAGG - Intergenic
943138419 2:183945826-183945848 ATATATATATAAAAGCAGGAGGG + Intergenic
943341122 2:186683459-186683481 TTTTACATTTAAAAGGAGGATGG + Intergenic
943508499 2:188793932-188793954 AAATTTAATTAAAAGGAGGTAGG - Intergenic
943662360 2:190572534-190572556 CTCTATTACTAAGAGGAGGAAGG + Intergenic
944200394 2:197100793-197100815 CTATATTATTAAAAGAAGTATGG - Intronic
944465791 2:199998149-199998171 CTAAATATTTAAAAGGATCAAGG - Intronic
944566977 2:201001198-201001220 CTAGATAATCAAATGTAGGAGGG - Intronic
944841449 2:203627844-203627866 ATAAATAAATAAAAGGAGGTGGG - Intergenic
945000229 2:205342117-205342139 CTGTATGACTAAAGGGAGGAAGG + Intronic
945695591 2:213099207-213099229 CTTTATAAAAGAAAGGAGGATGG - Intronic
945925394 2:215797689-215797711 GTAAATAATTAAAAGGAGGCTGG + Intergenic
946260381 2:218485301-218485323 ATATATATTTAAAGGAAGGAAGG - Intronic
1169702480 20:8463202-8463224 ATATATAATTAAAAGCATGCAGG - Intronic
1170674175 20:18463949-18463971 ATATATAATTAACATAAGGAAGG - Intronic
1172873668 20:38151169-38151191 TTTTCTAATTAAAAGAAGGATGG - Intronic
1173130587 20:40389294-40389316 CTATAAGGTTCAAAGGAGGAAGG + Intergenic
1173169531 20:40712911-40712933 ATAAATAAATAAAAGGAGAAGGG - Intergenic
1177241307 21:18461719-18461741 CTATATAATTAAAAGGAGGATGG - Intronic
1177283469 21:19016412-19016434 CTATATAATTATAGGTAAGATGG + Intergenic
1177359978 21:20055680-20055702 CGATATCACAAAAAGGAGGACGG + Intergenic
1177390589 21:20464866-20464888 CTACATAATGAAAAGAGGGATGG + Intergenic
1177583804 21:23062473-23062495 ACATATAATTGAAAGCAGGAAGG + Intergenic
1179371805 21:40812818-40812840 CTAGAAAAATAAAAGAAGGAGGG + Intronic
1182709971 22:32315294-32315316 ATAAATAATAAAAAGTAGGAGGG + Intergenic
1182766530 22:32761731-32761753 GTAAATAAATAAATGGAGGAAGG - Intronic
949824522 3:8151500-8151522 GTATATAACAAGAAGGAGGAAGG + Intergenic
950141323 3:10618018-10618040 ATATATAGATAAAAGCAGGAAGG + Intronic
951214863 3:20014354-20014376 ATATATCCTGAAAAGGAGGATGG - Intergenic
951308300 3:21094072-21094094 CTAGTTAAATAAAAAGAGGAAGG + Intergenic
954356736 3:50088299-50088321 CTAAAAAATAAAAAGGAGGCCGG - Intronic
954482614 3:50815117-50815139 CTATAAAAATAAAATGAGGCTGG - Intronic
955452687 3:59087031-59087053 GTATATAATTACCAGGAGAAGGG - Intergenic
956042878 3:65164045-65164067 CTACAAAATTAAGAGGAGGAGGG - Intergenic
957194517 3:77050302-77050324 TTATATACTTAAGATGAGGAAGG - Intronic
957909079 3:86598495-86598517 CTATAGAATTAAAAAGCGAAGGG + Intergenic
959441894 3:106386811-106386833 GTAAATAGTTAAAAGGAGGATGG - Intergenic
960042286 3:113162884-113162906 CTAGATAATTAAATGATGGAGGG + Intergenic
960629810 3:119718213-119718235 CTATATTCTCAAAAGGATGAGGG + Intronic
961397062 3:126601523-126601545 CGCTATAACTAAAATGAGGATGG - Intronic
961559967 3:127721960-127721982 TTACATATTTAAAAGGTGGAAGG + Intronic
962592931 3:136909036-136909058 CTACATAACAACAAGGAGGAAGG - Intronic
964341361 3:155712002-155712024 TTATTTAATTAAAAGGTGCAAGG - Intronic
964540805 3:157777533-157777555 TTAGAGAATTAAAAGCAGGATGG - Intergenic
964982233 3:162700232-162700254 GTATATAATTAAAAGAAGAAAGG - Intergenic
969180078 4:5433572-5433594 CTATAACATTTAAGGGAGGAAGG + Intronic
970555606 4:17228814-17228836 CTATCTAATTGAAAGGCAGAAGG + Intergenic
971655250 4:29336006-29336028 TTATAGAAGAAAAAGGAGGAAGG - Intergenic
971997566 4:33984922-33984944 ATATATATTTAAAAGGAGGATGG - Intergenic
972208601 4:36809338-36809360 CTCTATAATTAAAAACAGTATGG - Intergenic
972237321 4:37149650-37149672 CTAGATATTTAAAAGGAGTTGGG + Intergenic
972835131 4:42861486-42861508 CTATCTTCTTAAAGGGAGGATGG + Intergenic
973154614 4:46935331-46935353 TTATATATTTATTAGGAGGAAGG - Intronic
973222355 4:47742994-47743016 CTAAATAATTAAATGGTGGTGGG + Intronic
973859778 4:55051713-55051735 CTAAACAATTAGAAGGAGGAAGG + Intergenic
974314535 4:60261409-60261431 CCATAAAATTATAAGGAGAAAGG - Intergenic
974728034 4:65822019-65822041 CTTAAAAAATAAAAGGAGGAAGG - Intergenic
976580970 4:86736853-86736875 ATATATTATTAGAAGGAGTAGGG - Intronic
976814032 4:89125889-89125911 TTTTAGCATTAAAAGGAGGAAGG - Intergenic
977465406 4:97378254-97378276 CTAGATGACAAAAAGGAGGAAGG + Intronic
977495769 4:97773606-97773628 CTATTTATTTAAAAGCAGGCTGG - Intronic
978066322 4:104407191-104407213 TTCTATTATTAAAAGGAGAAGGG + Intergenic
978374227 4:108058271-108058293 CTATATAATTTAAAGGTGGTAGG + Intronic
978781393 4:112558703-112558725 TTAATTAATTAAATGGAGGAGGG - Intronic
979150041 4:117300287-117300309 CTATATAATGAAAAAGTGGTAGG + Intergenic
979894150 4:126136556-126136578 CTACAAAATGAAAAGGACGAAGG + Intergenic
980097094 4:128502262-128502284 TTAAATAAGTAAAAGGATGATGG - Intergenic
980531504 4:134061686-134061708 CTGTATACTTCAAAAGAGGAGGG + Intergenic
981029221 4:140107386-140107408 CTAAATCATTAAAATGAGGAAGG - Intronic
981679363 4:147377610-147377632 CCAGATAATAAAAAGAAGGATGG - Intergenic
981958867 4:150511360-150511382 CTATATGACTAAAAGCAGAAGGG - Intronic
982334996 4:154225374-154225396 GTAATTAATAAAAAGGAGGAGGG - Intergenic
982821878 4:159951012-159951034 CTATATTATTCAAAGAAGGAAGG + Intergenic
983047769 4:163007141-163007163 TTATAAAATTATTAGGAGGAAGG - Intergenic
983410646 4:167393214-167393236 TTATAGAATTAACAGGAGTATGG - Intergenic
984090139 4:175363266-175363288 ATGTATATTTAAAAGGATGAAGG - Intergenic
984407166 4:179348345-179348367 CTATATTACTAAAATCAGGATGG + Intergenic
985319882 4:188698971-188698993 GTATATAATTAACAGCATGAAGG + Intergenic
985983242 5:3489383-3489405 CTGTATAATTAAGTGGAGGCCGG + Intergenic
986171816 5:5320510-5320532 GCATTTAATTAAAAGGAGGTGGG + Intergenic
987111342 5:14690171-14690193 CTATATAATGATAAAGAGAAAGG + Exonic
987615344 5:20266742-20266764 CTAAATATTGAAAAGGAAGAGGG + Intronic
987806049 5:22769663-22769685 ATATAGAACTAATAGGAGGATGG - Intronic
988237812 5:28569180-28569202 CTATATATTTAAAGGTAGTATGG - Intergenic
989236586 5:39154886-39154908 TAATACAATTAAAAGGAGGCCGG - Intronic
990321924 5:54638304-54638326 CTAAAAAATAAAAAGGGGGAGGG + Intergenic
990983316 5:61620478-61620500 CTGTATAAATAAAAAGAGTAAGG + Intergenic
991608300 5:68425120-68425142 TTATATAATCAGAAGTAGGAAGG + Intergenic
991937863 5:71819599-71819621 GTATAAAATTAAAAAGAGAATGG + Intergenic
992228011 5:74637636-74637658 CTATTTAATCAAAAGACGGATGG - Exonic
992588708 5:78270854-78270876 CTACAGAATCAAAAGGAGGAGGG - Intronic
993197799 5:84771885-84771907 TTAAATATTTAAAAGGAGAAAGG - Intergenic
993326840 5:86550212-86550234 CCATATAATTAACAGTGGGATGG - Intergenic
993385433 5:87257319-87257341 TTATATTATTTAAAGAAGGAAGG - Intergenic
994450963 5:99942523-99942545 CTATAAAATTTATAGGAGGCTGG - Intergenic
995126622 5:108583298-108583320 CTAGAGAATAAAAGGGAGGAGGG + Intergenic
995360992 5:111296993-111297015 CTAAATAATTATAAGCAGGAAGG - Intronic
995456207 5:112354978-112355000 CAAAATAAACAAAAGGAGGAAGG + Intronic
995623170 5:114050239-114050261 GTATATCTTTAAAAGGAGAATGG - Intergenic
995926726 5:117383755-117383777 CTATATAATTTTAATGAGGCAGG + Intergenic
996914231 5:128693314-128693336 CTACATGGTTAAAAGGAGTAGGG + Intronic
998004438 5:138647806-138647828 TTAGCTAATTAAATGGAGGAGGG - Intronic
998688768 5:144562241-144562263 CTATATCAACAAAAGGAGCATGG - Intergenic
998890839 5:146744126-146744148 AAATATTATGAAAAGGAGGAAGG - Intronic
998901484 5:146860138-146860160 CTATAAAAGGAAAAGCAGGATGG - Intronic
999052300 5:148535688-148535710 CAAAATAATTAAAAGGAATAAGG + Intronic
1000200266 5:159002665-159002687 ATATATATAGAAAAGGAGGAAGG + Intronic
1001218666 5:169879847-169879869 CTATATAAGTAAAAAGGGCAAGG - Intronic
1003593056 6:7452094-7452116 CTATTTATTTAAAAAGAGCAAGG - Intergenic
1003678679 6:8230754-8230776 CATTAGAATTAACAGGAGGAAGG + Intergenic
1003784183 6:9465255-9465277 CTAAATAATGAAAATGGGGAAGG + Intergenic
1004569880 6:16834919-16834941 ATAAATAAATAAAAGGAGGGGGG - Intergenic
1004934006 6:20489962-20489984 CTCAAAAATTAAAAGGGGGACGG + Intronic
1004966564 6:20858399-20858421 GTATATAATTAGAAGAAGAAAGG + Intronic
1005254616 6:23987720-23987742 ATATAAAATTAAAAGGAGCAAGG + Intergenic
1005827614 6:29644244-29644266 CTGAATAATTATAAGTAGGATGG + Intergenic
1005897483 6:30190522-30190544 TTCTATTATTAAAAGGAGGAAGG - Intronic
1006656792 6:35601896-35601918 CTATGTAACTTAAAGGGGGAGGG + Intronic
1007055131 6:38875503-38875525 TAGTAAAATTAAAAGGAGGAAGG - Intronic
1008780446 6:55097044-55097066 CTATATTAGTAAAAGAAGAAAGG - Intergenic
1009629843 6:66181855-66181877 CTATCTAACAAAAAAGAGGAAGG - Intergenic
1011304582 6:85911861-85911883 CTGTATAATAAAAAAGAAGAGGG + Intergenic
1011554258 6:88558088-88558110 CTATATATTAAAAATGAGGAAGG - Intergenic
1014975759 6:127880236-127880258 GTCTAAAGTTAAAAGGAGGATGG + Intronic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1016624369 6:146148871-146148893 GTATATAATCAAAAACAGGAAGG - Intronic
1016627745 6:146192177-146192199 CATTCTCATTAAAAGGAGGATGG - Intronic
1016915795 6:149243222-149243244 CTATATATTTAAATCGAGAAAGG - Intronic
1017223256 6:151990838-151990860 CTATAGAATTAAAAGTGGAAGGG - Intronic
1017533519 6:155321886-155321908 TCACATAAGTAAAAGGAGGATGG - Intergenic
1018741327 6:166731426-166731448 ATTTATGATTAAAAGGGGGAAGG + Intronic
1020331181 7:7018426-7018448 GTTTACAATCAAAAGGAGGAGGG - Intergenic
1020931490 7:14402090-14402112 ATAAATAATTAAAAAGAGAATGG - Intronic
1021760702 7:23900784-23900806 CTAAATAAATAAAGGGAGGGAGG - Intergenic
1023336607 7:39177215-39177237 CTGAATCATTAAAAGGAGGGTGG - Intronic
1023556535 7:41429382-41429404 CTATATAATAAACATGAAGATGG + Intergenic
1023628594 7:42140803-42140825 TTATACAAGAAAAAGGAGGAGGG + Intronic
1023859356 7:44208274-44208296 CTATTATATTAAAACGAGGATGG - Intronic
1024706701 7:51969435-51969457 CTTTCTAATTAAAATGAGGGCGG + Intergenic
1027805734 7:82819749-82819771 ATATATAATTAATAGGGAGAAGG + Intronic
1029858422 7:103542933-103542955 TTATATTTTTAAAAGGAGTATGG + Intronic
1029864653 7:103614382-103614404 AGATATAAGTAAAAGGTGGAAGG + Intronic
1031303295 7:120090965-120090987 CTGTTTAAATGAAAGGAGGAAGG - Intergenic
1031335830 7:120530453-120530475 ATATATACTTCAAAGAAGGATGG - Intronic
1032719967 7:134542845-134542867 ATATATAATAAAAATGTGGATGG - Intergenic
1032733717 7:134670490-134670512 CTATAAAATTAAACGTAGAATGG + Intronic
1032987398 7:137353586-137353608 TAATATAATGAAAAGGAGCAAGG + Intergenic
1033495961 7:141896524-141896546 CCATATAAGTAAAAGGAAAAGGG - Intergenic
1033937081 7:146599493-146599515 GTATAGACATAAAAGGAGGAAGG - Intronic
1035562997 8:621521-621543 TTAAATAATTAAAAAGAGAAAGG + Intronic
1036954344 8:13171379-13171401 CTAAATAAGTAAAAGGAAGTAGG - Intronic
1038129897 8:24718136-24718158 CTATATTTTTAAAGGGAGGAGGG + Intergenic
1038883547 8:31639851-31639873 ATAAATAAATAAAAGGAGGAGGG + Intronic
1039798725 8:40936578-40936600 CTAAAAAATAAAAAGAAGGAAGG + Intergenic
1040033280 8:42845025-42845047 CTATATAAAGAAAAGGAGCAGGG - Intergenic
1040712233 8:50203071-50203093 ATATATAATGAAGAGGAAGAAGG - Intronic
1040758805 8:50812959-50812981 CTATGTAAGAAAAACGAGGATGG - Intergenic
1041322508 8:56628388-56628410 CTATCCATTGAAAAGGAGGAAGG - Intergenic
1041609980 8:59834398-59834420 CTTTATAATTCAAAGGAGGCAGG - Intergenic
1041967007 8:63689769-63689791 CTATATAAAAAACAAGAGGAAGG - Intergenic
1043104089 8:76085929-76085951 CTATATAAATACATGGAAGAAGG - Intergenic
1044081173 8:87886476-87886498 CTTTATCATTAAAAGGATAAAGG + Intergenic
1044271299 8:90247274-90247296 TTATAGAATTAAAAGGGTGATGG - Intergenic
1044891748 8:96843318-96843340 TTATTGAATGAAAAGGAGGAAGG + Intronic
1045091640 8:98751654-98751676 CAATATCATTAAAATGAGGCTGG + Intronic
1045218509 8:100173854-100173876 CAAGATAAATAAAAGTAGGAAGG + Intronic
1045866688 8:106874247-106874269 TTTTAAAATTAAAAAGAGGAAGG + Intergenic
1045890235 8:107147280-107147302 CTATATAATCAAAACTTGGAAGG + Intergenic
1046494717 8:114998669-114998691 CAATAAAAAAAAAAGGAGGAAGG - Intergenic
1047902235 8:129435885-129435907 CTATATAATCAAAATGTGTATGG - Intergenic
1048015972 8:130498336-130498358 ATAAATAAATAAAAGGAGGAGGG - Intergenic
1048561387 8:135541487-135541509 CAATAAAATTAAAAGTTGGAAGG + Intronic
1048843345 8:138583970-138583992 TTAAATCATTAAAAGGAGGGAGG - Intergenic
1048937228 8:139367320-139367342 CTCTAAAAGTTAAAGGAGGATGG + Intergenic
1049735103 8:144200633-144200655 CTAGAGAATTCAAAGCAGGATGG - Intronic
1050614438 9:7387629-7387651 CTATTTACTTAAAAGGGGAAGGG - Intergenic
1051097847 9:13487019-13487041 AAAAATAAGTAAAAGGAGGAAGG + Intergenic
1051118540 9:13726176-13726198 CTATTTAAATAAAAGGATGACGG - Intergenic
1051958532 9:22729119-22729141 CAATGTCATTAAATGGAGGAAGG + Intergenic
1052321020 9:27167617-27167639 ATATATAATTAAAAGGTAGAAGG + Intronic
1052908407 9:33857763-33857785 CTATATACTTAAAAGCATAAAGG - Intronic
1054801247 9:69351304-69351326 CTAAATACTCAAAAGGATGAAGG - Intronic
1055224432 9:73977188-73977210 CTACATAAGTAGAAAGAGGAAGG + Intergenic
1055764892 9:79652125-79652147 ATATATTTTTAAAAGGGGGAAGG - Intronic
1056614635 9:88153360-88153382 AAAAATAATTAAATGGAGGAAGG - Intergenic
1059679320 9:116570941-116570963 GTATATTTTTAAAAGGAAGAAGG + Intronic
1060417220 9:123439741-123439763 AAATATAATTACAAGTAGGAAGG + Intronic
1060508108 9:124213411-124213433 CCAAATAATTAAAGCGAGGAGGG - Intergenic
1060844339 9:126823682-126823704 CTAAATAATAAAAAGTAGGATGG - Intronic
1061525636 9:131159208-131159230 CTATATAATTAAAATGAGGCCGG - Intronic
1061693005 9:132349909-132349931 CTTTATATCTAAAAAGAGGAGGG - Intronic
1185558390 X:1039385-1039407 CTAAAAAAATAAAAAGAGGATGG + Intergenic
1185788162 X:2907730-2907752 CTATTCAGTGAAAAGGAGGAGGG + Intronic
1188347454 X:29084609-29084631 TTATAGAATTAAAAGAAGTAGGG + Intronic
1188630438 X:32351253-32351275 CCATAGATTTCAAAGGAGGAAGG - Intronic
1190244602 X:48683045-48683067 CTCTGTAATTAAAAGGAAAAGGG + Intronic
1190514048 X:51204782-51204804 ATATATAAATAAAAGGATGATGG + Intergenic
1190626308 X:52341637-52341659 CTGTATAATTTACAGGAGGATGG - Intergenic
1193489097 X:82125943-82125965 CTATAAAAATAAAAAGAGAAAGG + Intergenic
1194865500 X:99060688-99060710 AAATGTAATTTAAAGGAGGATGG - Intergenic
1195611878 X:106876747-106876769 TTACATAATTATCAGGAGGATGG + Intronic
1195652672 X:107301380-107301402 CTATATAATCAAAAGGGGTAAGG + Intergenic
1195725432 X:107910665-107910687 GGCTATTATTAAAAGGAGGAAGG - Intronic
1196154798 X:112416985-112417007 CAATGTAATCCAAAGGAGGAGGG + Intergenic
1196594394 X:117526730-117526752 TGATATCACTAAAAGGAGGAAGG - Intergenic
1196686837 X:118517698-118517720 CTAGATCATTAAAATTAGGATGG + Intronic
1197883012 X:131189111-131189133 CTATACCATTAAAATGAGGGTGG + Intergenic
1198063408 X:133070918-133070940 CTATAAAATTAAATGGTGGCCGG + Intronic
1199572663 X:149283372-149283394 CCACAAAATTAAAAGGTGGAGGG - Intergenic
1200825534 Y:7635599-7635621 CTTTAAAATGAATAGGAGGATGG - Intergenic
1202234523 Y:22695496-22695518 CTTTAAAATGAATAGGAGGATGG + Intergenic
1202275538 Y:23115562-23115584 TGTTAAAATTAAAAGGAGGAAGG + Intergenic
1202290490 Y:23305129-23305151 TGTTAAAATTAAAAGGAGGAAGG - Intergenic
1202308636 Y:23500672-23500694 CTTTAAAATGAATAGGAGGATGG - Intergenic
1202428530 Y:24749281-24749303 TGTTAAAATTAAAAGGAGGAAGG + Intergenic
1202442261 Y:24920808-24920830 TGTTAAAATTAAAAGGAGGAAGG - Intergenic
1202562165 Y:26169914-26169936 CTTTAAAATGAATAGGAGGATGG + Intergenic