ID: 1177243869

View in Genome Browser
Species Human (GRCh38)
Location 21:18497169-18497191
Sequence TCCATGGTTGTCTACGTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177243867_1177243869 0 Left 1177243867 21:18497146-18497168 CCTTTGTCAATAAATTATGGACG No data
Right 1177243869 21:18497169-18497191 TCCATGGTTGTCTACGTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177243869 Original CRISPR TCCATGGTTGTCTACGTATG TGG Intergenic
No off target data available for this crispr