ID: 1177244249

View in Genome Browser
Species Human (GRCh38)
Location 21:18502219-18502241
Sequence CAGAGGAGATAGAGGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177244244_1177244249 11 Left 1177244244 21:18502185-18502207 CCAAAATAAAGAGAATAATTGAA No data
Right 1177244249 21:18502219-18502241 CAGAGGAGATAGAGGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177244249 Original CRISPR CAGAGGAGATAGAGGGATGG AGG Intergenic
No off target data available for this crispr