ID: 1177249210

View in Genome Browser
Species Human (GRCh38)
Location 21:18570331-18570353
Sequence GCAGCAGCAGTTCCTCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177249210_1177249216 14 Left 1177249210 21:18570331-18570353 CCGCAGGGAGGAACTGCTGCTGC No data
Right 1177249216 21:18570368-18570390 ACTGCTATAGTGGAAGCTGCGGG No data
1177249210_1177249215 13 Left 1177249210 21:18570331-18570353 CCGCAGGGAGGAACTGCTGCTGC No data
Right 1177249215 21:18570367-18570389 CACTGCTATAGTGGAAGCTGCGG No data
1177249210_1177249214 4 Left 1177249210 21:18570331-18570353 CCGCAGGGAGGAACTGCTGCTGC No data
Right 1177249214 21:18570358-18570380 GTGAAGAAACACTGCTATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177249210 Original CRISPR GCAGCAGCAGTTCCTCCCTG CGG (reversed) Intergenic
No off target data available for this crispr