ID: 1177252308

View in Genome Browser
Species Human (GRCh38)
Location 21:18610121-18610143
Sequence GGTCACTGGAAACATGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177252302_1177252308 30 Left 1177252302 21:18610068-18610090 CCATAAGCTGAGTGAAAAGAAGA No data
Right 1177252308 21:18610121-18610143 GGTCACTGGAAACATGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177252308 Original CRISPR GGTCACTGGAAACATGATGA AGG Intergenic
No off target data available for this crispr