ID: 1177253064

View in Genome Browser
Species Human (GRCh38)
Location 21:18621810-18621832
Sequence GACCCAGGGCTTTTTTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177253061_1177253064 -10 Left 1177253061 21:18621797-18621819 CCATTACTTCCCAGACCCAGGGC No data
Right 1177253064 21:18621810-18621832 GACCCAGGGCTTTTTTCCACTGG No data
1177253058_1177253064 6 Left 1177253058 21:18621781-18621803 CCAGTAGATATCTGCACCATTAC No data
Right 1177253064 21:18621810-18621832 GACCCAGGGCTTTTTTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177253064 Original CRISPR GACCCAGGGCTTTTTTCCAC TGG Intergenic
No off target data available for this crispr