ID: 1177253397

View in Genome Browser
Species Human (GRCh38)
Location 21:18626575-18626597
Sequence CACTGAGGGCCTGTAGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177253390_1177253397 30 Left 1177253390 21:18626522-18626544 CCCTAAATTGCTGTGAAATACAT No data
Right 1177253397 21:18626575-18626597 CACTGAGGGCCTGTAGTGGCAGG No data
1177253392_1177253397 -5 Left 1177253392 21:18626557-18626579 CCTAGATCCAGAAATATTCACTG No data
Right 1177253397 21:18626575-18626597 CACTGAGGGCCTGTAGTGGCAGG No data
1177253391_1177253397 29 Left 1177253391 21:18626523-18626545 CCTAAATTGCTGTGAAATACATT No data
Right 1177253397 21:18626575-18626597 CACTGAGGGCCTGTAGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177253397 Original CRISPR CACTGAGGGCCTGTAGTGGC AGG Intergenic
No off target data available for this crispr