ID: 1177254614

View in Genome Browser
Species Human (GRCh38)
Location 21:18644978-18645000
Sequence CACTCCCACTGGAGGCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177254609_1177254614 9 Left 1177254609 21:18644946-18644968 CCAGAGTCCAAATCAAGGTGTTG No data
Right 1177254614 21:18644978-18645000 CACTCCCACTGGAGGCTCTAGGG No data
1177254610_1177254614 2 Left 1177254610 21:18644953-18644975 CCAAATCAAGGTGTTGATAAGCA No data
Right 1177254614 21:18644978-18645000 CACTCCCACTGGAGGCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177254614 Original CRISPR CACTCCCACTGGAGGCTCTA GGG Intergenic
No off target data available for this crispr