ID: 1177262025

View in Genome Browser
Species Human (GRCh38)
Location 21:18742087-18742109
Sequence TCCCCTTAGGTCATAAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177262025_1177262027 4 Left 1177262025 21:18742087-18742109 CCTTTATTTATGACCTAAGGGGA No data
Right 1177262027 21:18742114-18742136 AATATGAATCCAAAATTCGTAGG No data
1177262025_1177262029 16 Left 1177262025 21:18742087-18742109 CCTTTATTTATGACCTAAGGGGA No data
Right 1177262029 21:18742126-18742148 AAATTCGTAGGAATACAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177262025 Original CRISPR TCCCCTTAGGTCATAAATAA AGG (reversed) Intergenic
No off target data available for this crispr