ID: 1177262027

View in Genome Browser
Species Human (GRCh38)
Location 21:18742114-18742136
Sequence AATATGAATCCAAAATTCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177262026_1177262027 -9 Left 1177262026 21:18742100-18742122 CCTAAGGGGATAAAAATATGAAT No data
Right 1177262027 21:18742114-18742136 AATATGAATCCAAAATTCGTAGG No data
1177262025_1177262027 4 Left 1177262025 21:18742087-18742109 CCTTTATTTATGACCTAAGGGGA No data
Right 1177262027 21:18742114-18742136 AATATGAATCCAAAATTCGTAGG No data
1177262021_1177262027 11 Left 1177262021 21:18742080-18742102 CCATTATCCTTTATTTATGACCT No data
Right 1177262027 21:18742114-18742136 AATATGAATCCAAAATTCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177262027 Original CRISPR AATATGAATCCAAAATTCGT AGG Intergenic
No off target data available for this crispr