ID: 1177262029

View in Genome Browser
Species Human (GRCh38)
Location 21:18742126-18742148
Sequence AAATTCGTAGGAATACAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177262025_1177262029 16 Left 1177262025 21:18742087-18742109 CCTTTATTTATGACCTAAGGGGA No data
Right 1177262029 21:18742126-18742148 AAATTCGTAGGAATACAAAATGG No data
1177262026_1177262029 3 Left 1177262026 21:18742100-18742122 CCTAAGGGGATAAAAATATGAAT No data
Right 1177262029 21:18742126-18742148 AAATTCGTAGGAATACAAAATGG No data
1177262021_1177262029 23 Left 1177262021 21:18742080-18742102 CCATTATCCTTTATTTATGACCT No data
Right 1177262029 21:18742126-18742148 AAATTCGTAGGAATACAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177262029 Original CRISPR AAATTCGTAGGAATACAAAA TGG Intergenic
No off target data available for this crispr