ID: 1177262407

View in Genome Browser
Species Human (GRCh38)
Location 21:18748442-18748464
Sequence AGGACACTCCCTGCCCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177262407_1177262417 28 Left 1177262407 21:18748442-18748464 CCTGTGGGGGCAGGGAGTGTCCT No data
Right 1177262417 21:18748493-18748515 CAGTTCCACAGCCACAGCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177262407 Original CRISPR AGGACACTCCCTGCCCCCAC AGG (reversed) Intergenic
No off target data available for this crispr