ID: 1177262410

View in Genome Browser
Species Human (GRCh38)
Location 21:18748462-18748484
Sequence TGTACTCTCAGGGGCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177262410_1177262417 8 Left 1177262410 21:18748462-18748484 CCTCCTGGGCCCCTGAGAGTACA No data
Right 1177262417 21:18748493-18748515 CAGTTCCACAGCCACAGCTTCGG No data
1177262410_1177262418 11 Left 1177262410 21:18748462-18748484 CCTCCTGGGCCCCTGAGAGTACA No data
Right 1177262418 21:18748496-18748518 TTCCACAGCCACAGCTTCGGTGG No data
1177262410_1177262421 28 Left 1177262410 21:18748462-18748484 CCTCCTGGGCCCCTGAGAGTACA No data
Right 1177262421 21:18748513-18748535 CGGTGGCTGCAGCTGTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177262410 Original CRISPR TGTACTCTCAGGGGCCCAGG AGG (reversed) Intergenic
No off target data available for this crispr