ID: 1177262411

View in Genome Browser
Species Human (GRCh38)
Location 21:18748465-18748487
Sequence CTCTGTACTCTCAGGGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 701
Summary {0: 3, 1: 14, 2: 54, 3: 159, 4: 471}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177262411_1177262421 25 Left 1177262411 21:18748465-18748487 CCTGGGCCCCTGAGAGTACAGAG 0: 3
1: 14
2: 54
3: 159
4: 471
Right 1177262421 21:18748513-18748535 CGGTGGCTGCAGCTGTGCCTAGG No data
1177262411_1177262418 8 Left 1177262411 21:18748465-18748487 CCTGGGCCCCTGAGAGTACAGAG 0: 3
1: 14
2: 54
3: 159
4: 471
Right 1177262418 21:18748496-18748518 TTCCACAGCCACAGCTTCGGTGG No data
1177262411_1177262417 5 Left 1177262411 21:18748465-18748487 CCTGGGCCCCTGAGAGTACAGAG 0: 3
1: 14
2: 54
3: 159
4: 471
Right 1177262417 21:18748493-18748515 CAGTTCCACAGCCACAGCTTCGG No data
1177262411_1177262423 29 Left 1177262411 21:18748465-18748487 CCTGGGCCCCTGAGAGTACAGAG 0: 3
1: 14
2: 54
3: 159
4: 471
Right 1177262423 21:18748517-18748539 GGCTGCAGCTGTGCCTAGGAGGG No data
1177262411_1177262422 28 Left 1177262411 21:18748465-18748487 CCTGGGCCCCTGAGAGTACAGAG 0: 3
1: 14
2: 54
3: 159
4: 471
Right 1177262422 21:18748516-18748538 TGGCTGCAGCTGTGCCTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177262411 Original CRISPR CTCTGTACTCTCAGGGGCCC AGG (reversed) Intergenic
900615491 1:3563873-3563895 CTCTGGCCTCTCAGGGCACCTGG - Intronic
901242278 1:7702461-7702483 CTCTGTACTCTAAAGTGCCGGGG - Intronic
901637909 1:10678959-10678981 GTCTGTCCTGCCAGGGGCCCAGG - Intronic
902191029 1:14763408-14763430 CGCTTTATCCTCAGGGGCCCTGG - Intronic
902644853 1:17791046-17791068 CTCTGCACTCTTAGGGGCCCAGG - Intronic
902796537 1:18804129-18804151 CTCTGTGCTCTGCGGGTCCCTGG + Intergenic
903013704 1:20348406-20348428 CGCGGTAACCTCAGGGGCCCAGG - Intronic
903101635 1:21035417-21035439 CTCAATGCTCTCAGGGGCCTGGG + Intronic
903165185 1:21515312-21515334 CTCAGCACTTTCAGGGGCCAAGG - Intronic
903772520 1:25772820-25772842 CTCTGTGCTCTCTGGGCCCTGGG + Intronic
903812988 1:26045406-26045428 CTCTGGCCTCTGAAGGGCCCCGG - Intronic
904215983 1:28919703-28919725 CTCAGCACTCTCAGAGGCCAAGG - Intronic
904360441 1:29967779-29967801 CTCTCAACGCTCAGGAGCCCAGG - Intergenic
904364603 1:30002314-30002336 CCCTGAACTCCCAGGGGCCCAGG - Intergenic
904365792 1:30010294-30010316 CCCTGCACTCTTGGGGGCCCAGG - Intergenic
904443695 1:30550727-30550749 CTCTGGATTCTTGGGGGCCCAGG + Intergenic
904460941 1:30679511-30679533 CCCTGCACTCTTGGGGGCCCAGG + Intergenic
905545967 1:38801028-38801050 CTCTGCACTCTTAGGAGCCCAGG + Intergenic
905787755 1:40771456-40771478 CTCTTTTCTCCCAGGGACCCAGG + Intronic
906051902 1:42881126-42881148 CCTTGCACTCTCGGGGGCCCAGG - Intergenic
906132530 1:43469136-43469158 CTGGGCACTCTCAGGGGCCTGGG - Intergenic
906327479 1:44856388-44856410 CCCTGTAGTCTCAGCTGCCCGGG + Intronic
906777722 1:48544723-48544745 TTCTGTAGTCTCAGGGTCTCAGG - Intronic
907020103 1:51059174-51059196 CCCTGAGGTCTCAGGGGCCCCGG + Intergenic
907186810 1:52615810-52615832 CTATGAACTCTCAGGGGCCGAGG + Intergenic
907767521 1:57424835-57424857 CTGCGTGCTCTCAGGGGCACGGG - Intronic
907985245 1:59524040-59524062 CCCTACGCTCTCAGGGGCCCAGG + Intronic
909197673 1:72648430-72648452 CTCTGTACTCTCCGGGTCTGGGG + Intergenic
909907739 1:81220667-81220689 CCCTGCACTCTCAGGGGCACGGG + Intergenic
910602228 1:89043929-89043951 CTCTGCACTCCCAGGGGCCCAGG - Intergenic
910655060 1:89610439-89610461 CTCTGCACTCTCAGGGGACCTGG - Intergenic
911266844 1:95753416-95753438 CACTGCACTCTTAGGGGCCCAGG + Intergenic
911288763 1:96029150-96029172 CTCTGCACTCTCAAGGGCCCAGG - Intergenic
911539977 1:99146494-99146516 CTCTGTGCTCTTGGGGGCCTGGG + Intergenic
911599896 1:99836493-99836515 CTCTCTAATCTCAGGTACCCAGG - Intergenic
911935256 1:103961163-103961185 CCCTGCGCTCTCAAGGGCCCAGG - Intergenic
912763167 1:112386552-112386574 CTCTGCACCCTCAGGGGCCCAGG + Intergenic
912868549 1:113281751-113281773 CACTGTACTCTGAGGTTCCCTGG - Intergenic
916078580 1:161217972-161217994 CTCTATCCCCTCAGCGGCCCTGG + Exonic
916466163 1:165076514-165076536 CTCTGAATTCAGAGGGGCCCAGG - Intergenic
916595364 1:166237271-166237293 CCCTGTCCTCTCAGGGTACCAGG - Intergenic
918820535 1:189249609-189249631 CTCTTCACTCTCATAGGCCCAGG + Intergenic
918983807 1:191596750-191596772 CTCTGCACTCTTGGAGGCCCAGG - Intergenic
919083318 1:192891728-192891750 CTCTGCACTCTTTGGAGCCCGGG - Intergenic
919249249 1:195030974-195030996 CCCTGTGCTCTCAGGGGCCCAGG - Intergenic
919253790 1:195096138-195096160 CCCTGCACTCTAGGGGGCCCAGG + Intergenic
919263923 1:195237440-195237462 CCCTGTATTCTCAGGGGCCTGGG + Intergenic
919453899 1:197801061-197801083 CTCTGCACTCTTGGGGGCCCAGG + Intergenic
920085216 1:203410564-203410586 CTCTCTACTTTCAGGGTTCCCGG + Intergenic
920506922 1:206521790-206521812 GTCTGTCTTCTCAGGGGCCCAGG + Intronic
921097704 1:211901497-211901519 CTCTGCACTCTTGGGGGCCTGGG + Intergenic
921672305 1:217939355-217939377 CTCTGTACTCTCTGCAGCCACGG + Intergenic
921808888 1:219489110-219489132 CCCAGTACTTTCAGGGGCCCAGG + Intergenic
922132661 1:222795104-222795126 CTCTACACTCTTAGGGGCCCTGG + Intergenic
922774572 1:228208797-228208819 CTCTGGTCTTCCAGGGGCCCGGG - Intronic
923755178 1:236785468-236785490 CTCTGCACTCTCTGGGGCCTGGG + Intergenic
923918062 1:238530623-238530645 CTCTGTGCTCTCGGGGACTCAGG - Intergenic
923938249 1:238789808-238789830 CTCTGTTCTGACAGGGCCCCAGG + Intergenic
924147987 1:241097112-241097134 CTCTGTGCTCTCAAAGGCCTTGG - Intronic
924179350 1:241424759-241424781 CTCTGCACCCTCGGGGGCCCAGG + Intergenic
1062771548 10:105159-105181 GTCTGCACTCTCGGGGACCCAGG - Intergenic
1062958202 10:1554027-1554049 CTCCGTCCTCTCAGGGGGCCTGG + Intronic
1064811109 10:19199548-19199570 CTCAGTACTTTGAGAGGCCCAGG + Intronic
1065805969 10:29394217-29394239 ATCTCTCCTCTCAGGAGCCCAGG + Intergenic
1065942814 10:30580355-30580377 ATCTCTCCTCTCAGGAGCCCAGG - Intergenic
1065976464 10:30846773-30846795 CTCTGCACTCTCAGGGGTCCAGG + Intronic
1066088097 10:31990821-31990843 CTCAGTACTTTCAGAGGCCAAGG + Intergenic
1066188807 10:33036901-33036923 CCCTGCACTCTCGGGGGCCCAGG + Intergenic
1068137616 10:52965847-52965869 CCCTGTTTTCTCCGGGGCCCAGG - Intergenic
1068222834 10:54064828-54064850 CTCTGTGCTCTCAGGGATCCAGG - Intronic
1068266612 10:54657505-54657527 CTCTGTACTCTCAGCCTCGCAGG + Intronic
1068474329 10:57506697-57506719 CTCCGCACTCTCAGGGATCCAGG + Intergenic
1068921544 10:62489742-62489764 CACTGTTCTTTCAGGTGCCCAGG - Intronic
1069086810 10:64150296-64150318 GTCTGTCCTCAAAGGGGCCCTGG - Intergenic
1069121710 10:64576550-64576572 CTCTGAACTCTTGGGGTCCCCGG + Intergenic
1069278715 10:66626135-66626157 ATCTGAAATCTCAGGGGCACTGG + Intronic
1069561880 10:69436278-69436300 CCCTGCACTCTCAGAGGCCCGGG - Intergenic
1069657128 10:70098214-70098236 CTCTGTGCACTCTGTGGCCCAGG - Intronic
1069705183 10:70455061-70455083 GTCTATAGCCTCAGGGGCCCTGG + Intergenic
1070201284 10:74208179-74208201 CCCTGCACTCTCTGGGGCCCGGG - Intronic
1070232589 10:74585565-74585587 TGCTGTACTCTCAGGGGAGCAGG + Intronic
1070428687 10:76315374-76315396 CCCTGTGCTCTCAGGGGCCTGGG + Intronic
1071060981 10:81570737-81570759 CCCTGCACTCTCAGGGGCCCAGG - Intergenic
1071524740 10:86351982-86352004 CTCTTTACACACAGGGTCCCTGG - Intronic
1073844976 10:107544729-107544751 CCCTGTGCTCTCAGGGGCCCAGG + Intergenic
1074028691 10:109663425-109663447 CTCTGCACTCTTGCGGGCCCAGG + Intergenic
1074452831 10:113573250-113573272 CTCTTTGCTCTCTGGGGCCTTGG - Intronic
1075273458 10:121073284-121073306 CTCTTAAATCTCATGGGCCCAGG - Intergenic
1076616512 10:131758840-131758862 CTCTCTGCTCTCCGGGGCCAGGG - Intergenic
1076618211 10:131770826-131770848 CTCTGTGCTCCCCTGGGCCCAGG - Intergenic
1076655252 10:132019530-132019552 CCCTGCACTCTTGGGGGCCCAGG - Intergenic
1077113595 11:872921-872943 CCCAGTGCTCTCAGGGGTCCTGG - Intronic
1077409096 11:2395254-2395276 CTCTGCACTCTCAGCTGCCCCGG - Intronic
1077938759 11:6817978-6818000 CCCTGCACTCTTGGGGGCCCAGG + Intergenic
1078315278 11:10289229-10289251 CTTTGCACTCTCAGGGGCCAGGG - Intronic
1078345632 11:10545156-10545178 CCTTGTGCTCTCAGGGGCCCAGG - Intergenic
1078422877 11:11226575-11226597 CTCTGAATTCTCAGGGTCCTGGG - Intergenic
1079059567 11:17236257-17236279 CACTGTAACCTCTGGGGCCCAGG - Intronic
1079673942 11:23202219-23202241 CCCTGCACTCTCAGGAGCCCAGG + Intergenic
1079710819 11:23680370-23680392 CTCTGCACTCTTAGGGGCCCAGG - Intergenic
1080333845 11:31174191-31174213 CTCTGCACTGTCAGAGGCCTGGG + Intronic
1080402005 11:31945018-31945040 CTCAGTAATGTCAGGGGCCCAGG - Intronic
1080954762 11:37080471-37080493 CTCTGTGCACTCTGTGGCCCGGG + Intergenic
1080967092 11:37225194-37225216 CTCTGCACTCTCAGGGGCCCAGG - Intergenic
1081044210 11:38251116-38251138 CCCTGCAGTCTTAGGGGCCCAGG - Intergenic
1081284104 11:41246442-41246464 CTCTGCACTCTCAGGGGCCAAGG - Intronic
1081690393 11:45074051-45074073 CTCTTTACACTCTGGGGCCAGGG + Intergenic
1082952346 11:58830902-58830924 CTCTGTGTTCTTGGGGGCCCAGG + Intergenic
1083487767 11:62994410-62994432 CCCTGCACTCTCTGGGGCTCAGG - Intronic
1083865359 11:65450769-65450791 CTCTGCACTTTGAGGGGCCAAGG - Intergenic
1083902575 11:65650730-65650752 CACAGTGCCCTCAGGGGCCCAGG - Exonic
1084378922 11:68798345-68798367 CTCTCTAGCCTCAGGGGGCCGGG - Intronic
1084961703 11:72720262-72720284 CTCTGGACTCTCAGGGGCCCGGG + Intronic
1085050497 11:73377640-73377662 ATCTGTATTCTCAGCGGACCCGG + Intronic
1085212281 11:74791745-74791767 CCCTGTGCTCTTGGGGGCCCAGG - Intronic
1085334378 11:75679679-75679701 CCCCGCACTCTCAGGGGCCCAGG - Intergenic
1085435074 11:76493037-76493059 CCGTGTGCTCTCAGGGGCCAGGG + Intronic
1086092659 11:83020211-83020233 CCCTGTACTCTTGGGGGTCCAGG + Intronic
1086508385 11:87529072-87529094 CTCTACACTCTCAGAGGCCCAGG - Intergenic
1087407964 11:97752840-97752862 CCCTGTGTTCTCAGGGGCCCAGG - Intergenic
1088288088 11:108207728-108207750 CCCTGCACTCTCGGGGGCCAGGG - Intronic
1088328918 11:108629561-108629583 CCCTGCTCTCTCAGGGGCCCAGG - Intergenic
1089292338 11:117444931-117444953 CTCTGTTTTCAAAGGGGCCCTGG - Intronic
1089462372 11:118660725-118660747 CTCTGTCCTCACAGGAGACCGGG - Exonic
1090214229 11:124946825-124946847 ATCTCTACTCTCAGGGGAACTGG - Intergenic
1090652300 11:128817729-128817751 CTCTGTACACTGAGGGAGCCTGG - Intergenic
1090746061 11:129705663-129705685 CTCTGACCTCTCTGGGTCCCTGG - Intergenic
1092247979 12:6873767-6873789 CTCCTTACCCTCAGGGGCGCAGG - Intronic
1092272145 12:7031614-7031636 CCCTGTCCTCTCAGTGGGCCAGG - Intronic
1092979750 12:13782843-13782865 ATCTGTACTTTCAGAGTCCCTGG - Intronic
1093317294 12:17667054-17667076 TCCTGCACTCTCAGGGGCCCAGG - Intergenic
1093461590 12:19412154-19412176 CTGTGGACTCTCAGAGGCCCTGG + Intronic
1093502518 12:19828415-19828437 CTCTGCACTCTCAGAGACCCAGG - Intergenic
1093765061 12:22953010-22953032 CACTGCATTATCAGGGGCCCAGG - Intergenic
1094675047 12:32611883-32611905 TCCTGTGCTCTCAGGGGCCCGGG + Intronic
1095095081 12:38143012-38143034 CTGTGTCCCCCCAGGGGCCCTGG + Intergenic
1095145381 12:38720965-38720987 CCCTGTACCCTTGGGGGCCCAGG + Intronic
1095749782 12:45697346-45697368 CCCTGCACTCTCAGGGACCCGGG - Intergenic
1097130979 12:56810516-56810538 CCCTGCACTCTTGGGGGCCCAGG - Intergenic
1097446578 12:59679095-59679117 CTCTGCACTCTTGGGGGCCTAGG - Intronic
1097450809 12:59734455-59734477 CCCTGCACTCTCTGGGGCCCAGG - Intronic
1097500177 12:60392094-60392116 CTCTGCCCTCTCAGGGGTCCAGG + Intergenic
1097536219 12:60873334-60873356 CTCTGCATTCTCAGGGGCCCGGG - Intergenic
1098519718 12:71421338-71421360 CTCTGAACTCTCAGGGGCCTGGG - Intronic
1098790485 12:74816537-74816559 CTCTGTGCTCTTGGGGGCCCAGG + Intergenic
1098803097 12:74986046-74986068 CTCTGCACTCTCAGGGGCCTGGG - Intergenic
1098951499 12:76644969-76644991 CTCTGCACTCTCAGGGCTCCGGG + Intergenic
1100219206 12:92485716-92485738 CTCTTTACCCTCAGGCGGCCTGG - Intergenic
1100847800 12:98678643-98678665 CCCTGTACTCTTGGGGGACCTGG + Intronic
1101764048 12:107682435-107682457 GCCTGTGCCCTCAGGGGCCCGGG - Intergenic
1102475113 12:113183860-113183882 CACTGTACTCTCCGCCGCCCAGG + Intronic
1103080011 12:118016551-118016573 CTCTGAACTCTCAGATACCCAGG - Intronic
1103249461 12:119487131-119487153 GTCTGTGCTCTCACGGGCCTGGG - Intronic
1103749748 12:123150774-123150796 CTCTGTCCTCTTCGGGGCCCCGG + Intergenic
1104760436 12:131294955-131294977 CTCCCTACTCTCAGTGGACCTGG + Intergenic
1104819343 12:131665830-131665852 CTCCCTACTCTCAGTGGACCTGG - Intergenic
1104966950 12:132512632-132512654 CTCTGTACTCACAGGAGCCCGGG - Intronic
1105041769 12:132966748-132966770 CTCTGCACTCTGGAGGGCCCAGG + Intergenic
1105295658 13:19086271-19086293 CCCTTTCCTCTCAGGGCCCCAGG - Intergenic
1105429844 13:20326596-20326618 CTCTCTATGCTCAGAGGCCCTGG + Intergenic
1105861205 13:24415696-24415718 CCCAGTACTTTCAGAGGCCCAGG + Intergenic
1106022574 13:25929395-25929417 CTTGGTGCTCTCAGGTGCCCAGG - Intronic
1106999659 13:35527728-35527750 CCCTATGTTCTCAGGGGCCCTGG - Intronic
1107412096 13:40167286-40167308 CTCTGCATTCTCTGTGGCCCAGG - Intergenic
1107699925 13:43036969-43036991 AACCGCACTCTCAGGGGCCCAGG - Intronic
1107841037 13:44458624-44458646 CCCTGTGCTCTCGGGGACCCAGG + Intronic
1108269968 13:48749901-48749923 CTCTTTTCTCTGAGGGCCCCCGG - Intergenic
1108559516 13:51628447-51628469 CCCTGGACTCTCAGGGGCCTGGG - Intronic
1108844437 13:54660374-54660396 TCCTGAACTCTCAGGGGCTCCGG - Intergenic
1109348380 13:61145125-61145147 CCTTGTGCTCTCAGGGGCCCAGG + Intergenic
1109525152 13:63566096-63566118 CTCTGAACTCTCGGGGGCCTAGG + Intergenic
1109770387 13:66963222-66963244 CTCTGGCCTATTAGGGGCCCAGG - Intronic
1109837370 13:67877423-67877445 CTCTGCACTCTTGGGGGCCTAGG + Intergenic
1109982208 13:69923884-69923906 CTCTGCACTCTTGGGGGCCTGGG + Intronic
1110439214 13:75508335-75508357 TCCTGTGCTCTCAGGGGCCTGGG - Intergenic
1110730890 13:78877311-78877333 TCCTGCACTCTCAGGGGCCCAGG - Intergenic
1110939396 13:81330579-81330601 CACTGCACTCTTGGGGGCCCAGG + Intergenic
1111002593 13:82205247-82205269 CTCTGCACTCTCAGGAGTCCGGG + Intergenic
1111237711 13:85431015-85431037 CTCTGCACTCTTAGGAGCCCAGG + Intergenic
1111253673 13:85639103-85639125 CTCTGCACTCTCGGGGGCCTGGG - Intergenic
1111474253 13:88725144-88725166 CTCTGTGCTCTCGGGGGCCTGGG + Intergenic
1111595285 13:90403626-90403648 CCCTGTACTCTCAGGGGCCCAGG + Intergenic
1112402310 13:99087061-99087083 CTCTGTCCCCGCAGAGGCCCCGG - Intergenic
1113970586 13:114185556-114185578 TTCTGCACTCTCAGGAGCCCAGG + Intergenic
1114349661 14:21836056-21836078 CTCTGTACTCTTGAGGGCCTGGG - Intergenic
1115059030 14:29168410-29168432 ACCTGTGCTCTCAGGGGCCCAGG + Intergenic
1116019204 14:39441061-39441083 CCCTGTGCTCTCTGGGGCCCAGG + Intergenic
1116151347 14:41145704-41145726 CCCTGTGTTCTCAGGGGCCTGGG - Intergenic
1116167178 14:41349468-41349490 CCTTGTGCTCTGAGGGGCCCAGG + Intergenic
1116437498 14:44911756-44911778 CTGTGTACTCTCAAAGCCCCAGG - Intergenic
1116448632 14:45039740-45039762 TCCTGTGTTCTCAGGGGCCCTGG - Intronic
1117247886 14:53903918-53903940 CCCAGTACTCTCAGAGGCCAAGG - Intergenic
1118036870 14:61877520-61877542 TTTTGAACCCTCAGGGGCCCAGG - Intergenic
1118522241 14:66597599-66597621 TTCTGCACTCTCAAGGGCCTAGG - Intronic
1118947116 14:70398663-70398685 CTCTTCACCCTCAGGGGCCCAGG - Intronic
1119257272 14:73209110-73209132 CCCTGTGCTCTCAGGGGTCCAGG - Intronic
1119666204 14:76486787-76486809 CCCTGCACTCCCAGGGGCACGGG + Intronic
1120405639 14:84090929-84090951 TTCTGAACTCTCAGGGGGCCTGG + Intergenic
1120589975 14:86363717-86363739 CACTGCACTCTCAGGGGTCTGGG + Intergenic
1120708720 14:87771459-87771481 CTGTGTCCCCCCAGGGGCCCTGG - Intergenic
1121348894 14:93157162-93157184 CTCGGGGCTCTCAGGGGTCCTGG - Intergenic
1121528096 14:94633426-94633448 CTCTGTGCTCTTGGGGACCCAGG - Intergenic
1122488869 14:102099814-102099836 CTCCGTTCTCACAGGGACCCTGG + Intronic
1124188883 15:27554223-27554245 CACTGTGGTCTCAGGGCCCCTGG - Intergenic
1124467964 15:29956627-29956649 CTCAGTACTTTCAGTGGCCAAGG + Intronic
1124820754 15:33043936-33043958 CTCTGCACTCTCAGGGACCCAGG + Intronic
1125381684 15:39092823-39092845 CTCTGCACTCTTAGGGGCTTGGG - Intergenic
1125752258 15:42036835-42036857 CTGTGTGCTCTTGGGGGCCCTGG + Intronic
1127053930 15:55113057-55113079 CTCTGTCCTCTCAGATTCCCTGG + Intergenic
1127111167 15:55672444-55672466 CTCTATACTCTCAGTGGCTTAGG - Exonic
1127283710 15:57514400-57514422 CTCTGCACTTTAAGAGGCCCAGG - Intronic
1127555428 15:60082803-60082825 CTGTGTCCTCTCTGGGACCCAGG - Intergenic
1127994348 15:64144411-64144433 CTCTGGACTCCCTGGGGTCCTGG + Intronic
1128965175 15:72051519-72051541 GTCTGCACTCTCAGAGGCCCAGG + Intronic
1129543750 15:76373520-76373542 CTCTGTCCTCTCTGTGGACCAGG - Intronic
1131468337 15:92673538-92673560 CCCTGTGCCCTCAGGGGTCCAGG - Intronic
1132065183 15:98725123-98725145 CTTTCTACTCTCAGGGGCCCTGG + Intronic
1132312303 15:100866098-100866120 CACTGACCTCTCATGGGCCCTGG - Intergenic
1132851140 16:2025560-2025582 CTCTCGTCTCTCCGGGGCCCTGG - Intronic
1132903455 16:2270651-2270673 TTCTGGAGCCTCAGGGGCCCTGG + Intergenic
1132978924 16:2724959-2724981 CCCTGTGCTCTCGGGGGGCCTGG + Intergenic
1133047773 16:3098768-3098790 CTCTGGGCTCTCAGGTGACCTGG - Intronic
1133077489 16:3290961-3290983 TTCTTTGGTCTCAGGGGCCCCGG - Exonic
1133227359 16:4348100-4348122 GTATCTATTCTCAGGGGCCCTGG - Intronic
1133684686 16:8154933-8154955 CTCTGAATGCCCAGGGGCCCAGG + Intergenic
1133965020 16:10524757-10524779 CTCTGCACTCTGGGAGGCCCAGG - Intergenic
1134254486 16:12600383-12600405 CCCTGTGCTCTCAGGGGGCTGGG + Intergenic
1135149072 16:19989531-19989553 CTTTGTACTTTCTGGGTCCCAGG + Intergenic
1135208152 16:20499806-20499828 CTCTGTCCCTTCAGGGGCCCGGG + Intergenic
1135210747 16:20523894-20523916 CTCTGTCCCTTCAGGGGCCCGGG - Intergenic
1137465599 16:48706054-48706076 CCCTGCACTATCAGGGGACCAGG - Intergenic
1137692816 16:50441252-50441274 ATCTGCACTCTCAGGGACCTGGG + Intergenic
1138878250 16:60979259-60979281 CCCTGCACTCTTGGGGGCCCAGG + Intergenic
1138925190 16:61581772-61581794 CTCTGTACTCTCGGAGGCCCAGG - Intergenic
1138998152 16:62477788-62477810 CCCTGTGCTCTCAGGGGATCAGG + Intergenic
1139088785 16:63618587-63618609 TCCTGTGCTCTCGGGGGCCCAGG - Intergenic
1139183033 16:64770302-64770324 CTCTGCACTCTCAGGGGCCTGGG + Intergenic
1139390076 16:66601796-66601818 CCCTGTACTCTTAGGGGCCCAGG - Intergenic
1142157814 16:88540590-88540612 CTCTGTCCCCTCAGAGCCCCAGG + Intergenic
1142306604 16:89289532-89289554 CTCAGTTCTCTCCGGGTCCCAGG + Intronic
1142497165 17:312174-312196 ATCTGTAGTCTCAGCTGCCCGGG + Intronic
1142752089 17:1995026-1995048 CCCTGTGCTTACAGGGGCCCTGG + Intronic
1142940776 17:3378469-3378491 CCCTGCACTCTTAGGGGTCCAGG - Intergenic
1143030566 17:3964750-3964772 CTCTGGGCTCTCCTGGGCCCGGG + Intergenic
1143434502 17:6913885-6913907 TCCTGTACTTTCAGGGTCCCTGG - Intronic
1143792604 17:9309556-9309578 ATGTGTACTATCAGGGGCCAGGG - Intronic
1144714415 17:17424184-17424206 CCCTGCACTCTTAGGGGCCCAGG + Intergenic
1145750213 17:27349711-27349733 CTCTGCACTTTTGGGGGCCCAGG + Intergenic
1145981756 17:29016820-29016842 CTCTGTGCACACAGGTGCCCAGG + Intronic
1146359070 17:32159513-32159535 CTCTGCAGTCTAAGGGGCCCAGG + Intronic
1147268939 17:39253278-39253300 ATCTGTACTCTCAGGGTCACGGG + Intergenic
1147876220 17:43622494-43622516 CTCTATACTCTCAGGGGAGAGGG + Intergenic
1148856922 17:50583987-50584009 CTCTGGACACTAAGGTGCCCCGG - Intronic
1149529291 17:57381777-57381799 CTTTGTATTTTCAGAGGCCCTGG + Intronic
1149743690 17:59073538-59073560 CTCAGTACTTTCAGAGGCCAAGG - Intronic
1149884561 17:60327704-60327726 TTCTGCACCCTCAGGGGTCCGGG + Intronic
1149935773 17:60805399-60805421 CTCTGACCTCTCAGGGTCTCTGG + Intronic
1150520935 17:65866113-65866135 CTCAGCACTCTCGGGGGCCTGGG + Intronic
1151371445 17:73648668-73648690 GTCTCTACTCTGGGGGGCCCTGG - Intergenic
1151699326 17:75734492-75734514 CTCTGTATTCCCATGGGTCCAGG + Intronic
1151764095 17:76123141-76123163 CCCTCTGCCCTCAGGGGCCCAGG - Intergenic
1151885679 17:76922071-76922093 CTCTGTCCTCTCAGTGGCCCTGG + Intronic
1152530263 17:80914489-80914511 CTCTGTGCTCTCAGGGGCCCAGG + Intronic
1153428882 18:4993434-4993456 CCCTGCACTCTTGGGGGCCCTGG - Intergenic
1153472990 18:5467937-5467959 CCCTGCACTCTCAGGGGTACAGG + Intronic
1153608067 18:6854793-6854815 CTCTGTACTCTTGGTGGCCTGGG + Intronic
1153723887 18:7936309-7936331 CTTTGCACTCTCAGGGACCCAGG + Intronic
1154241372 18:12657331-12657353 CTCTGACCTCCGAGGGGCCCCGG + Intronic
1156160254 18:34350758-34350780 CCCTGTACTCTTGGGGGGCCTGG + Intergenic
1157029284 18:43885773-43885795 CTCTCTACTCTCTGTCGCCCAGG + Intergenic
1157879390 18:51305364-51305386 CTCTGGAGACTCAGGGGCCAGGG + Intergenic
1158139570 18:54242173-54242195 CTCTGCACTCTTGGGGACCCAGG - Intergenic
1158787944 18:60739458-60739480 CCCTGTGCTCTTGGGGGCCCGGG + Intergenic
1159595334 18:70377661-70377683 CTCTGGAGTCTCAGAGGACCAGG - Intergenic
1160192106 18:76722889-76722911 CGCTATGCTGTCAGGGGCCCAGG + Intergenic
1160814467 19:1028752-1028774 CTCTGCCGGCTCAGGGGCCCAGG - Intronic
1161621330 19:5298861-5298883 CTCTGTCCTTCCAGGGGCTCAGG + Intronic
1161780076 19:6286089-6286111 CCCTGCACTCCTAGGGGCCCGGG + Intergenic
1162074866 19:8179279-8179301 CTCAGTACTCTGAGAGGCCAAGG - Intronic
1163087521 19:14993016-14993038 CTCTGCTCCCTCTGGGGCCCTGG - Intronic
1164984352 19:32637716-32637738 CTCTGCACTCTCAGGGGCCCAGG + Intronic
1165405563 19:35628896-35628918 CGCTGTGCTCTCATAGGCCCAGG + Intergenic
1165449239 19:35872632-35872654 CTCTGTACTGTAGGGGGTCCTGG - Intronic
1166010293 19:39936262-39936284 CTCTGGCCTCCCAGAGGCCCAGG - Intergenic
1166897381 19:46032504-46032526 CTCTGCACTCTTAGGGGCCTGGG + Intergenic
1166898043 19:46036319-46036341 CTCTGTGCTCTTGGGGGGCCAGG + Intergenic
1167270889 19:48505362-48505384 CTCAGTACTTTGAGAGGCCCAGG - Intronic
1167598477 19:50439821-50439843 CTCTGGGCTCTCACAGGCCCCGG - Intronic
1168612220 19:57810584-57810606 CTCCCTACTCTCAAGGACCCAGG + Intronic
925165588 2:1713749-1713771 CTCTTACCTCTCAGGGGCCCGGG - Intronic
925515211 2:4674335-4674357 CTCTGCACTCTCGGGGGCCCAGG + Intergenic
925910888 2:8572968-8572990 CTCTGCTCCCTCAGTGGCCCCGG - Intergenic
926547106 2:14255514-14255536 CCCTGTGCTCTCGGGGACCCAGG - Intergenic
926554458 2:14341354-14341376 CCCTGTGCTCTTGGGGGCCCAGG + Intergenic
926859381 2:17292215-17292237 CCCTGCACTCTTAGGGGCCCGGG - Intergenic
927577273 2:24210081-24210103 CACTGGCCTCTCAGGGGCACTGG - Intronic
927613659 2:24566913-24566935 CTCTGCACTCTTAGGGACCCAGG - Intronic
927743299 2:25591211-25591233 CTCTGCACTGTCAGGGGCCTGGG - Intronic
928470366 2:31569017-31569039 CCCTGTGCTCTCAGGGGCCTGGG - Intronic
928797091 2:35035061-35035083 CCCTGCACTCTTTGGGGCCCAGG - Intergenic
928917328 2:36486559-36486581 CTCTGTAAACTCAGGGGCAGAGG - Intronic
930800459 2:55438107-55438129 CTCTGTGCTCTTGGGGGCCCAGG + Intergenic
930957169 2:57217080-57217102 CTCTGCACTCTTGGGGGCCTAGG + Intergenic
931006634 2:57856849-57856871 CTCTGTCCACTGAGAGGCCCTGG - Intergenic
931300374 2:60973334-60973356 CTCTGCACTTTCAGGGACCCGGG + Intronic
932154865 2:69407201-69407223 CTCAGTACTTTGAGGGGCCAAGG - Intronic
932398358 2:71463369-71463391 CCCTGCACTCTCTGGGGCCCAGG - Intronic
932522336 2:72427363-72427385 CTCTGCACCCTCAGGGGCCCAGG + Intronic
932739153 2:74278571-74278593 CCCTGAAGTCTCAGAGGCCCTGG - Intronic
933415804 2:81985256-81985278 CCCTGTACTCGGAGCGGCCCCGG + Intergenic
933420752 2:82042888-82042910 CCCTGTGCAGTCAGGGGCCCAGG + Intergenic
934580333 2:95432770-95432792 CTGTGCACTCTCTGGGGCTCAGG - Intergenic
934599114 2:95643947-95643969 CTGTGCACTCTCTGGGGCTCAGG + Intergenic
934611641 2:95742232-95742254 CACAGTACTTTCAGGGGCCCAGG + Intergenic
934696626 2:96404923-96404945 CTCTGCACTCTTGGGGGCCCAGG - Intergenic
934750124 2:96788751-96788773 CTCTGAGATCCCAGGGGCCCAGG - Intronic
935230636 2:101092852-101092874 CTCTGTACACTGAGGGGACCTGG - Intronic
935381276 2:102453215-102453237 GTCTGTACTTCCAGGGGCCCAGG - Intergenic
935431130 2:102977089-102977111 CTCTGTTGTTTCAGGAGCCCTGG + Intergenic
936544977 2:113383845-113383867 CACAGTACTTTCAGAGGCCCAGG + Intergenic
937477342 2:122227358-122227380 CTCTGTCCTCACAGGGCCTCAGG - Intergenic
937543649 2:122989109-122989131 CTCTGTGCTCTTGGGGGCCCAGG + Intergenic
938180749 2:129179615-129179637 CTTTGCACTCTTGGGGGCCCAGG - Intergenic
939017738 2:136920987-136921009 CCCTGGGCTCTCAGGGGCCCAGG - Intronic
939085052 2:137708515-137708537 CCCTGTACTCTCGGGGGCCTAGG - Intergenic
939801778 2:146720294-146720316 CCCTGTGCTCTCAGGGACCTGGG + Intergenic
940035775 2:149310710-149310732 CTCTCTGCTCTCAGGAGGCCAGG + Intergenic
940396373 2:153196535-153196557 CTCTGCACTCTCGGGGGCCCAGG - Intergenic
940398808 2:153222872-153222894 CCCTGCGCTCTCAGTGGCCCAGG - Intergenic
940422918 2:153499849-153499871 CCCTGCACTCTCAGGGGACTGGG - Intergenic
940423877 2:153509213-153509235 CCCTGCACTCTCAGGGACCCTGG - Intergenic
940582712 2:155601397-155601419 CCCTGTCCTCTCAGGGCCCCGGG - Intergenic
940612300 2:156006814-156006836 CTCTGTACTCTTTGGGACCTGGG - Intergenic
940694377 2:156959893-156959915 CTCTGAACTCTCAGGGGCCCAGG - Intergenic
941043522 2:160648670-160648692 AACTGTACTCTCCCGGGCCCGGG + Intergenic
941736476 2:168982189-168982211 CTCTGTCTTCCCAGGGGCCATGG - Intronic
941740775 2:169032984-169033006 CCCTGAACTCTCCAGGGCCCTGG - Intergenic
941929308 2:170924586-170924608 CCCTATGCTCTCAGGGGCTCAGG - Intergenic
941998784 2:171626476-171626498 CCCTGTGCTCTTGGGGGCCCAGG + Intergenic
942134241 2:172909532-172909554 CAATGTCCTCTCTGGGGCCCTGG - Intronic
943190915 2:184679516-184679538 CTCTGCACTCCCGGGGGCTCAGG + Intronic
943223885 2:185144509-185144531 CCCTGAACTCTCAGGGGCCCAGG + Intergenic
943345750 2:186734996-186735018 CCCTCTGCTCTCAGGGGCCCAGG - Intronic
943827416 2:192413971-192413993 CCCTGTGTTCTCTGGGGCCCGGG + Intergenic
944146665 2:196514102-196514124 CCCTGCACTCTCAGGGGCCCAGG + Intronic
944483772 2:200182294-200182316 CCCTGCACTCTTGGGGGCCCAGG + Intergenic
944901914 2:204223919-204223941 CTCTGTGCTCTTGGGGGCCCAGG - Intergenic
945395224 2:209307786-209307808 CCCTGTGCTCTCAGGGGCCTGGG - Intergenic
945770488 2:214035678-214035700 CTCTGCACTCTTGGGGGCACAGG - Intronic
946049343 2:216849044-216849066 GTGTGTACTCTGAGGGACCCAGG + Intergenic
946327097 2:218990399-218990421 CTCTGTACCCTCACTGGCCTAGG - Exonic
946630496 2:221662417-221662439 ACCTGTAATCTCAGGGACCCAGG - Intergenic
947909644 2:233792652-233792674 CTCTGTCCTGGCTGGGGCCCAGG - Intronic
948476167 2:238221288-238221310 CCCTGCACTCTTGGGGGCCCGGG - Intergenic
949036679 2:241818693-241818715 CTCAGGGCTGTCAGGGGCCCCGG - Intergenic
1169200293 20:3706030-3706052 CTCTGTCCTCAGAGGAGCCCAGG - Exonic
1169309252 20:4521382-4521404 CCCTCCACTCTCAGGGGCCCAGG + Intergenic
1170156802 20:13276278-13276300 CTCTGTATTCTCAGTGGCGTTGG + Intronic
1170327763 20:15175935-15175957 CTCTGCACTCTCGGAGGCCTGGG + Intronic
1170590698 20:17769259-17769281 CTCTGTACCCTCAGAGTCCCAGG + Intergenic
1172883426 20:38216338-38216360 CCCTGTCCTCCCAGGGCCCCAGG + Intronic
1173207699 20:41007532-41007554 CTCTGCACTCTTGGGGGCCCAGG - Intergenic
1173625213 20:44467380-44467402 CTCTCTGTTCCCAGGGGCCCTGG - Intergenic
1173717778 20:45224694-45224716 CTCTGTACTAACAGGACCCCAGG + Intergenic
1174183321 20:48688621-48688643 CTCTGAACTCCCTGGGTCCCTGG - Intronic
1175064270 20:56272190-56272212 CTCTGTGCTCTTGGGGGACCAGG + Intergenic
1175064975 20:56276895-56276917 CTCTGTGCTCTTGGGGGCCTGGG + Intergenic
1175065016 20:56277111-56277133 CTCTGTATTCTTAGGGGCCCAGG + Intergenic
1175312962 20:58024536-58024558 CTCTGCATTTTCAGGGGACCAGG - Intergenic
1175776691 20:61658413-61658435 CTCTGAGCTCGCAGGTGCCCAGG + Intronic
1175870716 20:62208264-62208286 CTCTGGGCTCACAGGGGTCCCGG + Intergenic
1176104483 20:63379494-63379516 CTCTGCACTCTCGGAGGTCCAGG + Intergenic
1177262411 21:18748465-18748487 CTCTGTACTCTCAGGGGCCCAGG - Intergenic
1177396155 21:20538358-20538380 CCCTGTACTCTTGGGGGCCCAGG - Intergenic
1178937326 21:36874855-36874877 CCCTGCACTCTCGGGGGTCCAGG + Intronic
1179023381 21:37659119-37659141 AACTGTGCTCTCAGGGCCCCTGG + Intronic
1179433596 21:41344239-41344261 ACCTGGACTCTCAGGGGACCTGG - Intronic
1180050836 21:45330416-45330438 CTCAGCTCTCCCAGGGGCCCGGG - Intergenic
1180592934 22:16956179-16956201 CTCTGTACCCTCAACAGCCCAGG - Intergenic
1180749785 22:18116323-18116345 CTCTGAACTCCCAGGGCCCTGGG - Intronic
1180756062 22:18162048-18162070 CTCTATAATCTGAGGGGTCCAGG - Intronic
1181075705 22:20375355-20375377 CTCTATAATCTGAGGGGTCCAGG + Intronic
1181368333 22:22397175-22397197 CTCCCGACTCTCAGGGTCCCGGG + Intergenic
1183316733 22:37141211-37141233 CCCTGCACTCTCAGGGGCCCTGG + Intronic
1183403928 22:37620665-37620687 CTCTGGACTCTTAGTGGCCTGGG - Intronic
1184134319 22:42537689-42537711 CTCAGTACTTTGAGGGGCCGAGG + Intergenic
1184134600 22:42539698-42539720 CCCAGTACTCTGAGGGGCCGAGG + Intergenic
1184138290 22:42562245-42562267 ATGTGAACTCTCAGGGGCCCTGG - Intronic
1184252599 22:43269225-43269247 CTCTGGACTCTGACAGGCCCTGG + Intronic
1184560994 22:45262893-45262915 CTCTGCACTCTTGGGGGCCCTGG - Intergenic
1184865104 22:47197911-47197933 CTCTGTGTTCCCAGGGCCCCGGG + Intergenic
1185150241 22:49160060-49160082 CTCTGGCATGTCAGGGGCCCTGG - Intergenic
1185418938 22:50724552-50724574 CTCTGTTCTCCCAGGAGCCAGGG + Intergenic
950423046 3:12909873-12909895 CTCCGGGCTCTCAGGGTCCCTGG + Intronic
951718563 3:25674285-25674307 CCCTGTACTCTCAGGGACCCAGG - Intergenic
951777673 3:26326927-26326949 CTGTGTGCTCTCAGGGTGCCGGG - Intergenic
952907554 3:38152226-38152248 CTCTGTAGTGTCAGGGACCCAGG - Intergenic
953163685 3:40445255-40445277 CTCTGTGCTCTTGGGGGCCCAGG + Intergenic
953602972 3:44386536-44386558 CTCTGGGCTCTCAGGGGCCTGGG + Intronic
953801946 3:46031264-46031286 CTCTGCACTGTCGGGGGCCTGGG + Intergenic
954224656 3:49174034-49174056 CTCTTTACTCGGAGGGGCCCTGG + Intronic
954454594 3:50590874-50590896 CTCTGGGCTTTCAGGGGCACAGG - Intergenic
955303720 3:57809225-57809247 CCCTGCACTCTTGGGGGCCCAGG + Intronic
956344668 3:68265305-68265327 CTGTGTACTCCAAAGGGCCCTGG + Intronic
957136374 3:76294208-76294230 CTCTGCACTCTGGGAGGCCCAGG - Intronic
957156398 3:76550629-76550651 CCCTGCACTCTCAGGGGCCTGGG + Intronic
957417771 3:79929011-79929033 CCCTGTGCTCTCAGGGGCTCAGG + Intergenic
957459477 3:80497825-80497847 CCCTTCACTGTCAGGGGCCCAGG - Intergenic
957613957 3:82505355-82505377 CCCTGTGCCCTCGGGGGCCCAGG + Intergenic
957614445 3:82509229-82509251 CTCTATGTTCTTAGGGGCCCGGG + Intergenic
957646578 3:82938977-82938999 CCCAGCGCTCTCAGGGGCCCGGG + Intergenic
957665427 3:83218933-83218955 CCCTGTGCTCTCAGGGTCCTGGG - Intergenic
957730152 3:84124762-84124784 CTCTGCACTCTCTGGGGCCCAGG + Intergenic
957730238 3:84125354-84125376 CTCTGCACTCTCGGGGGCCCAGG + Intergenic
958418633 3:93906708-93906730 CTCTGTACTCTTGAGGGCCTGGG + Intronic
958797846 3:98725131-98725153 CTCTTCACTATCAAGGGCCCAGG + Intergenic
958977404 3:100682882-100682904 CTTTGCACTCTCAGGGGTCCAGG + Intronic
959037375 3:101383498-101383520 TCCTGTACTCTAAGGAGCCCAGG + Intronic
959389824 3:105759759-105759781 CCCTATACTCTTGGGGGCCCAGG - Intronic
959476668 3:106820996-106821018 CCCTGTGCTCTCGGGGGCCCAGG + Intergenic
960333763 3:116392276-116392298 CTCTGCACTCTAGGGGGCCTGGG + Intronic
960634338 3:119768525-119768547 CCCTGAACTCTTGGGGGCCCTGG - Intergenic
960962329 3:123080857-123080879 CTCTGTGGTGTCAGGGACCCAGG + Intronic
962933201 3:140056381-140056403 CTCTGTACCCGCAGGGCTCCAGG + Intronic
963250092 3:143095349-143095371 CCCTGTGCTCTCAGGGGCCTGGG + Intergenic
963483264 3:145903910-145903932 CTCTGCACTCTAGAGGGCCCAGG + Intergenic
963805040 3:149714337-149714359 CTCTGAACTCTCAGGGGCCCAGG + Intronic
963906204 3:150775098-150775120 CCCTGCGCTCTCGGGGGCCCAGG - Intergenic
964927930 3:161979392-161979414 CTCTGTGATCTCAGGGGCCTAGG - Intergenic
965005579 3:163018908-163018930 CCCTGCACTCTTGGGGGCCCAGG + Intergenic
965051482 3:163655184-163655206 CCCTGCACTCTCGGGGGTCCAGG - Intergenic
965061423 3:163789026-163789048 CCCTGTTCTCTCGGGGGCTCAGG - Intergenic
965118255 3:164519698-164519720 CTCTGGACTTCCAGGGGCCTGGG - Intergenic
965205275 3:165713590-165713612 CCCTGCACTCTCAGAGGCCTGGG - Intergenic
965272638 3:166638476-166638498 CTCTGCACTCTTGGAGGCCCAGG + Intergenic
965813505 3:172614747-172614769 CTCTGTGCTCTTGGGGGCCCAGG - Intergenic
965924389 3:173959060-173959082 CTCTGCACTCTCGAGGGCCTGGG - Intronic
966254087 3:177898493-177898515 ACCTGTGCTCTCAGGGGCCCTGG + Intergenic
966842333 3:184099878-184099900 GTGTGTTCTCTCCGGGGCCCCGG + Intronic
967696502 3:192538069-192538091 ATCTGTAATCTCAGGTGCTCAGG - Intronic
967855070 3:194111183-194111205 CTCTCTACTCTCAAGTACCCAGG + Intergenic
968127277 3:196169222-196169244 CTCTGAACTCCCAGAGGGCCAGG - Intergenic
968458278 4:710007-710029 CTCTGTACTGTCTGGTTCCCAGG + Intronic
968538764 4:1151570-1151592 CTCTGCACTCTAGGGGGCCCAGG - Intergenic
968838428 4:2982105-2982127 CCCTGTGCTCTCAGGAGCCCAGG - Intronic
968980878 4:3848776-3848798 CTCTGTGCTGTCAGTGGCCCGGG - Intergenic
969194090 4:5547050-5547072 CTCTGCACTCTTGGGGGTCCAGG + Intronic
969671833 4:8593953-8593975 GTCTGGGCTCTCAGGGGCCAAGG - Intronic
969693374 4:8720357-8720379 GTCTGTAATCTCAGGTACCCAGG + Intergenic
970959552 4:21856689-21856711 CTCTGCACTCTCAGGAGCCCTGG + Intronic
971834737 4:31748471-31748493 CCCTGAGCTCTCAGGGGCCCAGG - Intergenic
971869481 4:32216602-32216624 CTCTGTACTCTTGGGGACCCAGG - Intergenic
972358361 4:38303600-38303622 CCCTGTACTCTTGGGGGCCCAGG - Intergenic
974260377 4:59518356-59518378 CTCTGCACTCTCAGGGGCCCAGG - Intergenic
974420060 4:61662306-61662328 TACTGTACTCTTAGGGGCCTGGG + Intronic
974432474 4:61816857-61816879 CCCTGAGCTCTCAGGGACCCAGG + Intronic
974435020 4:61845614-61845636 CTCAGCACTCTCGGAGGCCCAGG - Intronic
974628819 4:64457410-64457432 CCTTGTGCTCTCAGGGGCCCAGG + Intergenic
974686913 4:65242520-65242542 CCCTGTATTGTCAGGGGCCCAGG - Intergenic
975254430 4:72216623-72216645 CTCTGCACTCCCAGTAGCCCAGG - Intergenic
975913560 4:79297470-79297492 CTTTGCACCCTCAGGAGCCCAGG + Intronic
976548251 4:86363353-86363375 CTCAGTACTCTCAGGGGGATTGG - Intronic
976647256 4:87399518-87399540 CTCTGCACTCTCAGGGGCCCAGG + Intergenic
976729003 4:88244154-88244176 GCCTGTACTCTCAGGGCCCTGGG + Intergenic
976734562 4:88296745-88296767 CCCTGCACTCTTGGGGGCCCTGG - Intergenic
977487409 4:97666002-97666024 CTCTGCACTCTTGGGAGCCCAGG - Intronic
978249206 4:106610361-106610383 CCCTGTACTCTTGGGGGCCTGGG + Intergenic
978498384 4:109384217-109384239 CTCTGTACTGTTGGGGGCCCAGG + Intergenic
979010704 4:115365489-115365511 TCCTGCACTCTTAGGGGCCCAGG + Intergenic
980309123 4:131102657-131102679 CTCTGTGCTCTCAGGAGCCAGGG - Intergenic
980450051 4:132958849-132958871 CTCTGCACTCTCAGGGGCCCAGG + Intergenic
980480832 4:133385293-133385315 CCCTGCACTCTCAGGGACCCAGG + Intergenic
980493500 4:133560737-133560759 CTCTGCACTCTCAGAGGCCCGGG - Intergenic
980544679 4:134244203-134244225 TTCTGTGCTCTTAGGGGCCCGGG + Intergenic
980731028 4:136824277-136824299 CTCTGCACTCTCAGGGGCCCAGG - Intergenic
980740656 4:136946428-136946450 CCCTGTACTCTCGGGAGCCTGGG + Intergenic
981861699 4:149363111-149363133 CTCTGTGCTCTCAGCAACCCAGG - Intergenic
982598940 4:157421124-157421146 CTCTTTCCTCTCAGGGACCGAGG - Intergenic
982802695 4:159723472-159723494 CCCTGCACACTCAAGGGCCCAGG - Intergenic
982904320 4:161048799-161048821 CCCTGTACTCTATGGGTCCCAGG - Intergenic
983491796 4:168398107-168398129 CTCCACACTCTCGGGGGCCCAGG + Intronic
983885512 4:172975922-172975944 CCCTGCACTCTTAGGGGCCTGGG - Intronic
984296552 4:177861653-177861675 CCCTGTGCTCTCGGGGGCCCAGG + Intronic
984506639 4:180627773-180627795 CTCTGTGGTATCAGGGACCCAGG + Intergenic
984634304 4:182094036-182094058 TTCTGTGCTCTGTGGGGCCCAGG - Intergenic
984758071 4:183342536-183342558 CTCTGGACTCTGTGGGCCCCAGG + Intergenic
985916056 5:2919926-2919948 CCCTGCACTCTCAGGAGCCTGGG + Intergenic
985964248 5:3327809-3327831 CTCCGCACTCACAGGGGCCCAGG + Intergenic
986449284 5:7850191-7850213 AGCTGTACTCTTTGGGGCCCAGG + Intronic
986923454 5:12717061-12717083 CTCTTTGCTCTCAGGAGCCAGGG + Intergenic
987135160 5:14893530-14893552 CTATTTGCTCTCAGAGGCCCAGG - Intergenic
987952025 5:24687706-24687728 CTCTGCACTCTCTGGAGCCTGGG - Intergenic
987999495 5:25330715-25330737 CTCTGTACTCTCAGGGGCCTGGG + Intergenic
988081247 5:26417241-26417263 CTCTGTGCTCCCAGGAGCCCGGG - Intergenic
989107019 5:37872652-37872674 CTCTATGGTATCAGGGGCCCAGG - Intergenic
989476255 5:41876981-41877003 CTTTGTGCTCTCAGGGCCCTTGG + Intergenic
989537525 5:42581852-42581874 CCCCGTGCTCTCGGGGGCCCAGG + Intronic
989821591 5:45800150-45800172 CCCTGTTCTCTCAGGGACCCAGG + Intergenic
990023615 5:51159493-51159515 CTCTGTGCTCTTGGGGGCCTGGG + Intergenic
990878665 5:60516991-60517013 CCCTGTACTCTCAGAAGCCCAGG + Intronic
991359383 5:65803523-65803545 CTCTGTACTCTCAGGGGCCCCGG - Intronic
992201486 5:74388969-74388991 CTCTATGCCCTCAGGGACCCAGG + Intergenic
992693222 5:79259831-79259853 CTCTGCACTCTCCGGGGCCTGGG - Intronic
992761763 5:79956670-79956692 CTCAGTACTGTGAAGGGCCCAGG - Intergenic
993103721 5:83574153-83574175 ATCTGTTCTCTCTGGGCCCCTGG + Intronic
993618131 5:90137300-90137322 CTCTGTGCTCTTGGGGGCCCAGG - Intergenic
993703443 5:91144089-91144111 CTCTGCACTCTCAAGGGCCCAGG - Intronic
994343982 5:98663646-98663668 CTCTGGACCCACAGGGGCCATGG + Intergenic
994753318 5:103764748-103764770 CCCTGCCCTCTCAGGGGCCTGGG - Intergenic
994936543 5:106259856-106259878 CTCCCTACTCTCAGGTACCCAGG - Intergenic
995020187 5:107358395-107358417 CTTTGTGCTCTCAGGGCCACTGG - Intergenic
995155602 5:108908786-108908808 CTCTGTACTTTCAGAGGCCAAGG + Intronic
995225010 5:109690957-109690979 CTCCGTGCGCTCAGGGGCTCTGG - Intronic
995331979 5:110956525-110956547 CTCTGCACTCTCAGTGGCCCGGG + Intergenic
996183727 5:120451447-120451469 CTCTGCACTGTCGGTGGCCCTGG - Intergenic
996431684 5:123386863-123386885 CTCTGCACTCCCAGGGACACAGG + Intronic
997203591 5:132027467-132027489 CTCTATGCTCTCAAAGGCCCTGG + Intergenic
998848877 5:146336190-146336212 CTCTGTCCTCTCAGGGGTCTGGG - Intronic
999136523 5:149323792-149323814 CACTCTACTCTCAGAGGCACTGG + Intronic
1000655843 5:163876860-163876882 CTTGGTGCTCTCAGGGGTCCCGG + Intergenic
1001249845 5:170138556-170138578 CTCTGCCCTGTCATGGGCCCTGG - Intergenic
1001699875 5:173699124-173699146 CTCTGTACCTTCCGGGCCCCTGG + Intergenic
1001806920 5:174594652-174594674 CTCTGTACCATGAGGGGTCCAGG - Intergenic
1002516948 5:179765999-179766021 ATCTGTACTCACAGGGGCAGAGG - Exonic
1002604402 5:180373657-180373679 CTCTTTACTCTCAGAGTCCCTGG - Intergenic
1002986111 6:2191497-2191519 CTCTGCACTCTTGGGGGCCCTGG + Intronic
1004501164 6:16211411-16211433 ATCTGTCCTCTCATGGGCTCAGG + Intergenic
1004530879 6:16454436-16454458 CTCTGTAGCCTCAGGGGTCAAGG + Intronic
1004720941 6:18266630-18266652 CCCTGCACTCTTGGGGGCCCAGG - Intergenic
1005021526 6:21423535-21423557 GCCTGCACACTCAGGGGCCCGGG - Intergenic
1005277941 6:24239652-24239674 CTCTTTACTCTCATGTTCCCAGG + Intronic
1005316940 6:24612199-24612221 CCCAATACTCTCAGAGGCCCAGG + Intronic
1005781840 6:29201168-29201190 CTCTGCACTCTTGGGGGCCTGGG + Intergenic
1006463898 6:34179509-34179531 CCCTGTGCTCTCAGGGCCCTGGG - Intergenic
1006806369 6:36792216-36792238 CTCTGTCTTCTCAGGGGCTTTGG - Intronic
1007201807 6:40115965-40115987 CTCTGTAGTGTTAGGGGCCCTGG + Intergenic
1008231512 6:48989747-48989769 CCCTGCATTCTCAGGAGCCCAGG + Intergenic
1008373806 6:50768407-50768429 CTTTGTACTCTCAGGTTCCTGGG + Intronic
1009241793 6:61193850-61193872 CTCTGCACTCTCGGGGGCCCAGG - Intergenic
1009588539 6:65637571-65637593 CACTGCACTCTTGGGGGCCCAGG + Intronic
1009643197 6:66363199-66363221 CCCCGCACTCTCAGAGGCCCAGG - Intergenic
1009846982 6:69146401-69146423 CTCTGCACTCTCAGAGACCCAGG - Intronic
1010519616 6:76817575-76817597 CTCTGCATTCTCGGGGGCCCAGG + Intergenic
1010534486 6:77011121-77011143 CCCTGTGCTCTCCAGGGCCCAGG + Intergenic
1011905815 6:92366020-92366042 CTCAGTCCTCTTAGGGTCCCTGG + Intergenic
1012709472 6:102581578-102581600 CTCTGTGTTCTCAGGGGCCCAGG + Intergenic
1013086890 6:106864478-106864500 CTCTGTGCTCTTTGGGGCCCAGG - Intergenic
1014227248 6:118862183-118862205 CCCTGCACTCTTGGGGGCCCAGG - Intronic
1014384621 6:120785726-120785748 CCCTGCACTTTCAGGGGCCCAGG + Intergenic
1014391578 6:120872016-120872038 TCCTGCACTCTCAGGGGCTCAGG + Intergenic
1014934900 6:127375692-127375714 CTCAGCACTTTCAGAGGCCCAGG - Intergenic
1014969085 6:127791967-127791989 CACTGCACTCTCAGGGCCCCAGG - Intronic
1015498063 6:133901636-133901658 CTCTGTACTCTGGGAGGCCAAGG + Intergenic
1016758949 6:147716409-147716431 CTCTGCACTCTCAGGGGCCTGGG - Intronic
1017522445 6:155213971-155213993 CTCTGCACTCTCAGGGGCCTAGG - Intronic
1017587856 6:155946976-155946998 TCCTGCACTCTCAGGGGCCCAGG + Intergenic
1018108036 6:160507593-160507615 CTGTGTACTCTCAGGAGGTCAGG - Intergenic
1018123716 6:160661492-160661514 CTGTGTACTCTCAGGAGGTCAGG - Intronic
1018231696 6:161681983-161682005 CTCTTTCCTCTCAGGAGTCCAGG - Intronic
1018670446 6:166172572-166172594 GGCTGCACTCTCAGGGGCCCTGG + Intergenic
1018733058 6:166667885-166667907 CTTTGTACACTCAGGGCCCAGGG - Intronic
1019787145 7:2984267-2984289 GTTTGTTCTATCAGGGGCCCTGG - Intronic
1019984328 7:4644139-4644161 CTCTGGACTCTGAGGTGCCTGGG + Intergenic
1020586670 7:10078622-10078644 CTCTGCACTCTTGGGGGCCCAGG + Intergenic
1021097159 7:16547525-16547547 CCCTGCACTCTCGGGGACCCAGG + Intronic
1022391792 7:29950118-29950140 CCCTGCACTCTCAGGAGCCCAGG + Intronic
1022742580 7:33137321-33137343 CCCTGCACTGTCGGGGGCCCGGG - Intronic
1023354074 7:39349829-39349851 CTCTGCACTCACAGGGCCCCAGG - Intronic
1023700131 7:42883946-42883968 CCCTGTGCTCTGGGGGGCCCAGG - Intergenic
1024053456 7:45644834-45644856 GTCTTTAATCTCAGAGGCCCTGG - Intronic
1024113461 7:46170394-46170416 CTCTGTTCTCTCACGGCTCCCGG - Intergenic
1024786299 7:52911450-52911472 CTCTGCACTCTCAGGGGCCTGGG - Intergenic
1027411768 7:77927343-77927365 CCCTGTACTTTCAGAGGCCAAGG + Intronic
1027735023 7:81920905-81920927 CCCTGTGCTCTCAGGGGCCCAGG - Intergenic
1027780020 7:82508385-82508407 CTCTGTGCTCTTGGGGGCCCAGG - Intergenic
1028111679 7:86949589-86949611 CTTGGCACTCTCAGGGGCCCAGG + Intronic
1028527500 7:91801759-91801781 CTCTGCACTCTCGGGGGCCTGGG - Intronic
1028640691 7:93039461-93039483 CTCTGTGCTTTCAGGGTCCCAGG + Intergenic
1029183199 7:98719704-98719726 ATCTGGACTCCCAGGGACCCAGG - Intergenic
1029327555 7:99823153-99823175 CCCTGCACTCTTGGGGGCCCAGG + Intergenic
1029899209 7:104022062-104022084 CTCTGCACTCTGGGGGACCCAGG + Intergenic
1030347740 7:108454048-108454070 CTATGTAATCACAGAGGCCCTGG + Intronic
1030484613 7:110149638-110149660 CTCTGCACTCTCAGGTGCCCAGG - Intergenic
1030756246 7:113291258-113291280 CACTGTGCTCTCAGGGGCCCAGG + Intergenic
1031265208 7:119572508-119572530 CCCTGCACTCTTGGGGGCCCAGG + Intergenic
1031922067 7:127609377-127609399 CCCTGCACTCTCAGGGGCACAGG - Intergenic
1032429838 7:131851514-131851536 CTCTTTACTTTCATGGGCCTCGG + Intergenic
1032658414 7:133955956-133955978 CTCTGGACTCTCAGGGGCCTGGG - Intronic
1033960254 7:146905338-146905360 ATCTGTCCTCTTAGGGGCTCCGG + Intronic
1034054635 7:148021665-148021687 CTCTGTGCTCTCAGAGGACTTGG + Intronic
1034210499 7:149358576-149358598 CTCTGCACTCTCAGGGACCCAGG - Intergenic
1034252282 7:149701920-149701942 CCCTGCAGTCTCAGGGGCCCTGG - Intergenic
1036672780 8:10804058-10804080 CTTTGTACTTTCATAGGCCCTGG - Intronic
1037150148 8:15626591-15626613 CTCTGCACTCTCAGTGGCCCAGG + Intronic
1037371480 8:18184014-18184036 CTCTATGCTTTCAGGGTCCCGGG + Intronic
1037535233 8:19817467-19817489 CTCTGGACTCTCAGCCGCCACGG - Exonic
1037805205 8:22054993-22055015 CTCGGTACCTTCAAGGGCCCAGG - Intronic
1039379958 8:37075902-37075924 CTCTCCCCTCTCAGGGCCCCTGG - Intergenic
1040008694 8:42642847-42642869 CTCTGCTCTCTCATGGGCTCTGG + Intergenic
1041205589 8:55495289-55495311 CTCTGTGCTCTTGGGGGTCCAGG - Intronic
1041274314 8:56142075-56142097 CCCTGTACTCTCTGGGGCCCAGG + Intergenic
1041792629 8:61714262-61714284 CTCTGACCTCTCCGGGCCCCGGG + Exonic
1042514497 8:69645097-69645119 CTCTGTGCACGCAGCGGCCCTGG - Intronic
1042625001 8:70748312-70748334 CCCTGCACTCGCAGGGGCCCAGG + Intronic
1043082640 8:75785002-75785024 CTCTGCACTCTCGGGTGCCTGGG - Intergenic
1043087258 8:75849873-75849895 CTCTGCACTCTTGGGGGCCTGGG - Intergenic
1043195434 8:77287069-77287091 CTCTGCACTCTTGGGGGCCCAGG + Intergenic
1043702932 8:83313254-83313276 CTCTGCACTCTCAGGGGCCCAGG - Intergenic
1043735107 8:83731340-83731362 CTCTGCGCTCTCCGGGGCCTGGG - Intergenic
1044409446 8:91867772-91867794 CTCTGCACTCTCGGGGGCCCAGG + Intergenic
1044775051 8:95678628-95678650 CTCTGCACTCTCAGGAGCCCAGG - Intergenic
1045300830 8:100908554-100908576 CCCTGTGCTCTCGGGGGCCCCGG - Intergenic
1046140336 8:110083115-110083137 CTCTGCACTCTCAAGAGCCTGGG + Intergenic
1046407377 8:113791333-113791355 CTCTGCACTCTTGGGGGCCTGGG - Intergenic
1046503839 8:115111898-115111920 CTCTGCAATCTCGAGGGCCCGGG - Intergenic
1046674767 8:117095064-117095086 CTCTGCACTCTTAGGGGCCTGGG - Intronic
1047176036 8:122541191-122541213 CTCTCAATTCTCAGGGGACCTGG + Intergenic
1047544038 8:125797907-125797929 CTCTGCACTCTTGGGGGCCCAGG - Intergenic
1048329086 8:133460182-133460204 CTGGGTGGTCTCAGGGGCCCGGG + Intronic
1048421800 8:134284511-134284533 CTCTGCACTCTTGGGGGCCCTGG - Intergenic
1048548053 8:135405167-135405189 CCCTGTGCTCTCAGGGGCCCAGG - Intergenic
1048980651 8:139702089-139702111 CTCTCTCCTCCCAGGGGCCTGGG + Intronic
1048991230 8:139761438-139761460 CCCAGAACTCTAAGGGGCCCGGG - Intronic
1049051569 8:140201083-140201105 CTCTGGACTCTTAGAGGCCTGGG - Intronic
1049439236 8:142601622-142601644 CTCTCCACACTCAGGGGACCTGG - Intergenic
1049684345 8:143933393-143933415 CTCTGACCTCACAGGGGCCCCGG + Intronic
1049823939 8:144654965-144654987 CCCTGCACTCTTGGGGGCCCAGG + Intergenic
1050182239 9:2934046-2934068 CTCTGCGCTCTTGGGGGCCCAGG + Intergenic
1050426445 9:5516879-5516901 CTCTGTACTCTCAGGGGCCCAGG - Intronic
1050589794 9:7149388-7149410 CCCTGTGCTCTCAGGGTCCCAGG - Intergenic
1050808799 9:9718548-9718570 CCCTGTGCTCTCAGAGACCCAGG + Intronic
1050941885 9:11471241-11471263 CCCTGCACTCTCAGGGGCCCAGG + Intergenic
1051001716 9:12290572-12290594 CCCTGCACTATCTGGGGCCCGGG + Intergenic
1051029710 9:12658942-12658964 CTCTGCATGATCAGGGGCCCTGG - Intergenic
1052115930 9:24648714-24648736 CCCTCTGCTCTCAGGGGCGCAGG + Intergenic
1052552641 9:29970254-29970276 CTCTGCACTCTCAGAGGCTCAGG - Intergenic
1052623398 9:30943727-30943749 CCCTGCACTCTCAGAGGCCTAGG + Intergenic
1052708027 9:32016503-32016525 CCCTGCACTCTCAGGGGCCTGGG - Intergenic
1053304615 9:36975312-36975334 CTCTGAACTCATGGGGGCCCGGG + Intronic
1053619232 9:39798966-39798988 CTCCATACTCTTGGGGGCCCAGG - Intergenic
1053877388 9:42558315-42558337 CTCTGTACTCTTGGGGGCCCAGG - Intergenic
1053895272 9:42736373-42736395 CTTTGTACTCTTGGGGGCCCAGG + Intergenic
1054234307 9:62543407-62543429 CTCTGTACTCTTGGGGGCCCAGG + Intergenic
1054264925 9:62908463-62908485 CTCCGTACTCTTGGGGGCCCAGG + Intergenic
1055374359 9:75633248-75633270 CTCAGTACTAGCAGGGGCCGTGG - Intergenic
1055467053 9:76576325-76576347 CTCTGTGTTCTAAGGGGCCTGGG + Intergenic
1055890999 9:81123092-81123114 CTCTGCACCCTTGGGGGCCCAGG - Intergenic
1055942650 9:81665021-81665043 GTCTGTTCTCCCAGGGGACCTGG - Intronic
1056488564 9:87083513-87083535 CTCTTTTCTCCCAGGGACCCAGG - Intergenic
1056986019 9:91364306-91364328 CCCTGTGCTCTTAGGGGGCCAGG + Intergenic
1056986047 9:91364399-91364421 CCCTGCACTCTTGGGGGCCCAGG + Intergenic
1057004637 9:91546594-91546616 CTCAGTTCTCTGATGGGCCCCGG - Intergenic
1057196607 9:93119109-93119131 CTCTGTTCTCACGGGGGACCTGG - Intergenic
1057510909 9:95678804-95678826 TTCTGCACTCTCAGGGACCTGGG - Intergenic
1058099170 9:100899580-100899602 CTCTGTGCTCTCATGGTACCTGG + Intergenic
1058904279 9:109469080-109469102 CTCTGGTGTCTCATGGGCCCAGG - Intronic
1059176776 9:112175273-112175295 CTCTGCACCCTGAGGGCCCCGGG - Intronic
1059436009 9:114276766-114276788 CTCTTCAATCTCAGGGGACCTGG - Intronic
1059708150 9:116842822-116842844 CTCTGAAGTCTCAGGCCCCCTGG - Intronic
1060180028 9:121527533-121527555 TTCTGTACTCTCGGGGGCCTGGG + Intergenic
1060697425 9:125721290-125721312 GTCTGTACTCTCAGCTGCTCAGG + Intergenic
1060751033 9:126169713-126169735 CTCTGTACCCTCAGGGGCACTGG - Intergenic
1061621862 9:131815819-131815841 CTCTCCCCTCTCAGGGGCACAGG - Intergenic
1062184656 9:135211522-135211544 CCCTGCACTCTTGGGGGCCCAGG + Intergenic
1062228789 9:135469439-135469461 CTCTGGACTCCCAGGGACACAGG + Intergenic
1062285864 9:135772225-135772247 CACTGTACCCACAGAGGCCCTGG + Intronic
1062329035 9:136028725-136028747 CTCTGCACTCTTGGGGGCCTGGG + Intronic
1062389875 9:136329765-136329787 CTGGGTACCCTGAGGGGCCCTGG + Intronic
1203785524 EBV:125444-125466 CTCTGGACTCCAAGGGGGCCAGG - Intergenic
1185935893 X:4257051-4257073 CCTTGCACTCTCAGGGGCCCAGG + Intergenic
1186428766 X:9486482-9486504 CGCTGTACTCTGAGAGGCCAAGG - Intronic
1187242199 X:17523538-17523560 CTCTGGACTGTCAGGAGCCTTGG - Intronic
1188756412 X:33969016-33969038 CTCTGCACTCTTGGGGGCCCAGG + Intergenic
1188771373 X:34158182-34158204 CTGTGCAGTCTCAGGTGCCCAGG - Intergenic
1189856459 X:45229438-45229460 CTCTGCACTCTCGGGGACCCGGG - Intergenic
1190360655 X:49645344-49645366 ATCTGCACTCTCAGGGTCCCAGG - Intergenic
1190496637 X:51033346-51033368 CTATCTGCTCTCAGAGGCCCAGG - Intergenic
1190509335 X:51160591-51160613 CTATCTGCTCTCAGAGGCCCAGG + Intergenic
1191016258 X:55813402-55813424 CCCTGCACTCTCAGGGGCCTGGG + Intergenic
1193250756 X:79288582-79288604 CAGTGTAATCTCAGGTGCCCTGG + Intergenic
1193554060 X:82932161-82932183 CTCTTTATTCTTGGGGGCCCAGG + Intergenic
1193738147 X:85185425-85185447 CTCTGGACCCACAGGGGCCAGGG - Intergenic
1195260658 X:103128297-103128319 CTCTCTACCCTCAGGAGGCCAGG - Intergenic
1195564368 X:106323873-106323895 CTCTGGACCCTCTGGGGCCCAGG - Intergenic
1195880390 X:109586747-109586769 CCCTGTACTCTCTAGGGTCCAGG - Intergenic
1195902707 X:109815447-109815469 GCCTGTACTCTCAGAGGCCAGGG - Intergenic
1196600856 X:117600403-117600425 CTGAGTTCTCTCAGGGCCCCAGG + Intergenic
1196812795 X:119642023-119642045 CTGTGCACTCTCCGGGGCCAGGG - Intronic
1196968464 X:121083836-121083858 CGCTGTACACTAAGGGTCCCAGG + Intergenic
1197526797 X:127574830-127574852 CCCTGTGCTCTCGGGGGCCTGGG + Intergenic
1197609636 X:128623645-128623667 CTCTGCACTCTTGGGGGCCTGGG - Intergenic
1199092237 X:143705580-143705602 CTCTGTACTCTTGGGGACCTGGG + Intergenic
1199559390 X:149146909-149146931 CCCTGCACTCTTAGGAGCCCAGG + Intergenic
1199746104 X:150772705-150772727 CTCTGGACTGGCAGGGGCCATGG + Intronic
1200068649 X:153517385-153517407 CTCTGCACTCACAGGTGCCATGG + Intergenic
1200089142 X:153626263-153626285 CTCTGGTTTCTCAGGGGCCAAGG - Intergenic
1200749233 Y:6929532-6929554 ACCACTACTCTCAGGGGCCCAGG - Intronic
1200821462 Y:7588026-7588048 CTCTGTACTCTCAGAGGGCATGG + Intergenic
1201368554 Y:13235265-13235287 CTCTGCACTCTCAGGGGCCCAGG - Intergenic
1201720294 Y:17089543-17089565 CCTTGTGCTCTCAGGGGCCCAGG + Intergenic
1202238842 Y:22744726-22744748 CTCTGTACTCTCAGAGGGCATGG - Intergenic