ID: 1177262411

View in Genome Browser
Species Human (GRCh38)
Location 21:18748465-18748487
Sequence CTCTGTACTCTCAGGGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177262411_1177262417 5 Left 1177262411 21:18748465-18748487 CCTGGGCCCCTGAGAGTACAGAG No data
Right 1177262417 21:18748493-18748515 CAGTTCCACAGCCACAGCTTCGG No data
1177262411_1177262423 29 Left 1177262411 21:18748465-18748487 CCTGGGCCCCTGAGAGTACAGAG No data
Right 1177262423 21:18748517-18748539 GGCTGCAGCTGTGCCTAGGAGGG No data
1177262411_1177262418 8 Left 1177262411 21:18748465-18748487 CCTGGGCCCCTGAGAGTACAGAG No data
Right 1177262418 21:18748496-18748518 TTCCACAGCCACAGCTTCGGTGG No data
1177262411_1177262421 25 Left 1177262411 21:18748465-18748487 CCTGGGCCCCTGAGAGTACAGAG No data
Right 1177262421 21:18748513-18748535 CGGTGGCTGCAGCTGTGCCTAGG No data
1177262411_1177262422 28 Left 1177262411 21:18748465-18748487 CCTGGGCCCCTGAGAGTACAGAG No data
Right 1177262422 21:18748516-18748538 TGGCTGCAGCTGTGCCTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177262411 Original CRISPR CTCTGTACTCTCAGGGGCCC AGG (reversed) Intergenic