ID: 1177262412

View in Genome Browser
Species Human (GRCh38)
Location 21:18748471-18748493
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177262412_1177262417 -1 Left 1177262412 21:18748471-18748493 CCCCTGAGAGTACAGAGATACCC No data
Right 1177262417 21:18748493-18748515 CAGTTCCACAGCCACAGCTTCGG No data
1177262412_1177262423 23 Left 1177262412 21:18748471-18748493 CCCCTGAGAGTACAGAGATACCC No data
Right 1177262423 21:18748517-18748539 GGCTGCAGCTGTGCCTAGGAGGG No data
1177262412_1177262424 26 Left 1177262412 21:18748471-18748493 CCCCTGAGAGTACAGAGATACCC No data
Right 1177262424 21:18748520-18748542 TGCAGCTGTGCCTAGGAGGGTGG No data
1177262412_1177262422 22 Left 1177262412 21:18748471-18748493 CCCCTGAGAGTACAGAGATACCC No data
Right 1177262422 21:18748516-18748538 TGGCTGCAGCTGTGCCTAGGAGG No data
1177262412_1177262418 2 Left 1177262412 21:18748471-18748493 CCCCTGAGAGTACAGAGATACCC No data
Right 1177262418 21:18748496-18748518 TTCCACAGCCACAGCTTCGGTGG No data
1177262412_1177262421 19 Left 1177262412 21:18748471-18748493 CCCCTGAGAGTACAGAGATACCC No data
Right 1177262421 21:18748513-18748535 CGGTGGCTGCAGCTGTGCCTAGG No data
1177262412_1177262426 28 Left 1177262412 21:18748471-18748493 CCCCTGAGAGTACAGAGATACCC No data
Right 1177262426 21:18748522-18748544 CAGCTGTGCCTAGGAGGGTGGGG No data
1177262412_1177262427 29 Left 1177262412 21:18748471-18748493 CCCCTGAGAGTACAGAGATACCC No data
Right 1177262427 21:18748523-18748545 AGCTGTGCCTAGGAGGGTGGGGG No data
1177262412_1177262425 27 Left 1177262412 21:18748471-18748493 CCCCTGAGAGTACAGAGATACCC No data
Right 1177262425 21:18748521-18748543 GCAGCTGTGCCTAGGAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177262412 Original CRISPR GGGTATCTCTGTACTCTCAG GGG (reversed) Intergenic
No off target data available for this crispr