ID: 1177262413

View in Genome Browser
Species Human (GRCh38)
Location 21:18748472-18748494
Sequence TGGGTATCTCTGTACTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177262413_1177262421 18 Left 1177262413 21:18748472-18748494 CCCTGAGAGTACAGAGATACCCA No data
Right 1177262421 21:18748513-18748535 CGGTGGCTGCAGCTGTGCCTAGG No data
1177262413_1177262417 -2 Left 1177262413 21:18748472-18748494 CCCTGAGAGTACAGAGATACCCA No data
Right 1177262417 21:18748493-18748515 CAGTTCCACAGCCACAGCTTCGG No data
1177262413_1177262418 1 Left 1177262413 21:18748472-18748494 CCCTGAGAGTACAGAGATACCCA No data
Right 1177262418 21:18748496-18748518 TTCCACAGCCACAGCTTCGGTGG No data
1177262413_1177262426 27 Left 1177262413 21:18748472-18748494 CCCTGAGAGTACAGAGATACCCA No data
Right 1177262426 21:18748522-18748544 CAGCTGTGCCTAGGAGGGTGGGG No data
1177262413_1177262423 22 Left 1177262413 21:18748472-18748494 CCCTGAGAGTACAGAGATACCCA No data
Right 1177262423 21:18748517-18748539 GGCTGCAGCTGTGCCTAGGAGGG No data
1177262413_1177262427 28 Left 1177262413 21:18748472-18748494 CCCTGAGAGTACAGAGATACCCA No data
Right 1177262427 21:18748523-18748545 AGCTGTGCCTAGGAGGGTGGGGG No data
1177262413_1177262425 26 Left 1177262413 21:18748472-18748494 CCCTGAGAGTACAGAGATACCCA No data
Right 1177262425 21:18748521-18748543 GCAGCTGTGCCTAGGAGGGTGGG No data
1177262413_1177262424 25 Left 1177262413 21:18748472-18748494 CCCTGAGAGTACAGAGATACCCA No data
Right 1177262424 21:18748520-18748542 TGCAGCTGTGCCTAGGAGGGTGG No data
1177262413_1177262422 21 Left 1177262413 21:18748472-18748494 CCCTGAGAGTACAGAGATACCCA No data
Right 1177262422 21:18748516-18748538 TGGCTGCAGCTGTGCCTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177262413 Original CRISPR TGGGTATCTCTGTACTCTCA GGG (reversed) Intergenic
No off target data available for this crispr