ID: 1177262418

View in Genome Browser
Species Human (GRCh38)
Location 21:18748496-18748518
Sequence TTCCACAGCCACAGCTTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177262410_1177262418 11 Left 1177262410 21:18748462-18748484 CCTCCTGGGCCCCTGAGAGTACA No data
Right 1177262418 21:18748496-18748518 TTCCACAGCCACAGCTTCGGTGG No data
1177262412_1177262418 2 Left 1177262412 21:18748471-18748493 CCCCTGAGAGTACAGAGATACCC No data
Right 1177262418 21:18748496-18748518 TTCCACAGCCACAGCTTCGGTGG No data
1177262411_1177262418 8 Left 1177262411 21:18748465-18748487 CCTGGGCCCCTGAGAGTACAGAG 0: 3
1: 14
2: 54
3: 159
4: 471
Right 1177262418 21:18748496-18748518 TTCCACAGCCACAGCTTCGGTGG No data
1177262413_1177262418 1 Left 1177262413 21:18748472-18748494 CCCTGAGAGTACAGAGATACCCA No data
Right 1177262418 21:18748496-18748518 TTCCACAGCCACAGCTTCGGTGG No data
1177262414_1177262418 0 Left 1177262414 21:18748473-18748495 CCTGAGAGTACAGAGATACCCAG No data
Right 1177262418 21:18748496-18748518 TTCCACAGCCACAGCTTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177262418 Original CRISPR TTCCACAGCCACAGCTTCGG TGG Intergenic
No off target data available for this crispr