ID: 1177262421

View in Genome Browser
Species Human (GRCh38)
Location 21:18748513-18748535
Sequence CGGTGGCTGCAGCTGTGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177262410_1177262421 28 Left 1177262410 21:18748462-18748484 CCTCCTGGGCCCCTGAGAGTACA No data
Right 1177262421 21:18748513-18748535 CGGTGGCTGCAGCTGTGCCTAGG No data
1177262415_1177262421 -1 Left 1177262415 21:18748491-18748513 CCCAGTTCCACAGCCACAGCTTC No data
Right 1177262421 21:18748513-18748535 CGGTGGCTGCAGCTGTGCCTAGG No data
1177262413_1177262421 18 Left 1177262413 21:18748472-18748494 CCCTGAGAGTACAGAGATACCCA No data
Right 1177262421 21:18748513-18748535 CGGTGGCTGCAGCTGTGCCTAGG No data
1177262419_1177262421 -8 Left 1177262419 21:18748498-18748520 CCACAGCCACAGCTTCGGTGGCT No data
Right 1177262421 21:18748513-18748535 CGGTGGCTGCAGCTGTGCCTAGG No data
1177262412_1177262421 19 Left 1177262412 21:18748471-18748493 CCCCTGAGAGTACAGAGATACCC No data
Right 1177262421 21:18748513-18748535 CGGTGGCTGCAGCTGTGCCTAGG No data
1177262416_1177262421 -2 Left 1177262416 21:18748492-18748514 CCAGTTCCACAGCCACAGCTTCG No data
Right 1177262421 21:18748513-18748535 CGGTGGCTGCAGCTGTGCCTAGG No data
1177262411_1177262421 25 Left 1177262411 21:18748465-18748487 CCTGGGCCCCTGAGAGTACAGAG 0: 3
1: 14
2: 54
3: 159
4: 471
Right 1177262421 21:18748513-18748535 CGGTGGCTGCAGCTGTGCCTAGG No data
1177262414_1177262421 17 Left 1177262414 21:18748473-18748495 CCTGAGAGTACAGAGATACCCAG No data
Right 1177262421 21:18748513-18748535 CGGTGGCTGCAGCTGTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177262421 Original CRISPR CGGTGGCTGCAGCTGTGCCT AGG Intergenic
No off target data available for this crispr