ID: 1177262517

View in Genome Browser
Species Human (GRCh38)
Location 21:18749299-18749321
Sequence GAGCAGCAGGAAGGCAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177262511_1177262517 17 Left 1177262511 21:18749259-18749281 CCAAAAAGAGTTTTAAGGAGCTC No data
Right 1177262517 21:18749299-18749321 GAGCAGCAGGAAGGCAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177262517 Original CRISPR GAGCAGCAGGAAGGCAAAGA GGG Intergenic
No off target data available for this crispr