ID: 1177262560

View in Genome Browser
Species Human (GRCh38)
Location 21:18749847-18749869
Sequence GAGTGGCCCTCAGCCCTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177262560_1177262567 18 Left 1177262560 21:18749847-18749869 CCAAGGAGGGCTGAGGGCCACTC No data
Right 1177262567 21:18749888-18749910 CCTCTTGGCATGACCAGCCTGGG No data
1177262560_1177262561 -7 Left 1177262560 21:18749847-18749869 CCAAGGAGGGCTGAGGGCCACTC No data
Right 1177262561 21:18749863-18749885 GCCACTCAGTGCTTGCCTGAAGG No data
1177262560_1177262563 3 Left 1177262560 21:18749847-18749869 CCAAGGAGGGCTGAGGGCCACTC No data
Right 1177262563 21:18749873-18749895 GCTTGCCTGAAGGCACCTCTTGG No data
1177262560_1177262565 17 Left 1177262560 21:18749847-18749869 CCAAGGAGGGCTGAGGGCCACTC No data
Right 1177262565 21:18749887-18749909 ACCTCTTGGCATGACCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177262560 Original CRISPR GAGTGGCCCTCAGCCCTCCT TGG (reversed) Intergenic
No off target data available for this crispr