ID: 1177262561

View in Genome Browser
Species Human (GRCh38)
Location 21:18749863-18749885
Sequence GCCACTCAGTGCTTGCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177262550_1177262561 24 Left 1177262550 21:18749816-18749838 CCTTCAGGAGCTGACAAGCACAG No data
Right 1177262561 21:18749863-18749885 GCCACTCAGTGCTTGCCTGAAGG No data
1177262560_1177262561 -7 Left 1177262560 21:18749847-18749869 CCAAGGAGGGCTGAGGGCCACTC No data
Right 1177262561 21:18749863-18749885 GCCACTCAGTGCTTGCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177262561 Original CRISPR GCCACTCAGTGCTTGCCTGA AGG Intergenic
No off target data available for this crispr