ID: 1177262567

View in Genome Browser
Species Human (GRCh38)
Location 21:18749888-18749910
Sequence CCTCTTGGCATGACCAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177262562_1177262567 1 Left 1177262562 21:18749864-18749886 CCACTCAGTGCTTGCCTGAAGGC No data
Right 1177262567 21:18749888-18749910 CCTCTTGGCATGACCAGCCTGGG No data
1177262560_1177262567 18 Left 1177262560 21:18749847-18749869 CCAAGGAGGGCTGAGGGCCACTC No data
Right 1177262567 21:18749888-18749910 CCTCTTGGCATGACCAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177262567 Original CRISPR CCTCTTGGCATGACCAGCCT GGG Intergenic
No off target data available for this crispr