ID: 1177266404

View in Genome Browser
Species Human (GRCh38)
Location 21:18790256-18790278
Sequence ATGTATTCTCTTAATGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177266404_1177266405 14 Left 1177266404 21:18790256-18790278 CCATCTTCATTAAGAGAATACAT No data
Right 1177266405 21:18790293-18790315 CTGCAGCATATATTTGAAAATGG No data
1177266404_1177266406 25 Left 1177266404 21:18790256-18790278 CCATCTTCATTAAGAGAATACAT No data
Right 1177266406 21:18790304-18790326 ATTTGAAAATGGACAACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177266404 Original CRISPR ATGTATTCTCTTAATGAAGA TGG (reversed) Intergenic
No off target data available for this crispr