ID: 1177268815

View in Genome Browser
Species Human (GRCh38)
Location 21:18819672-18819694
Sequence CCTGGGAAATTGTACCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177268815_1177268820 4 Left 1177268815 21:18819672-18819694 CCATCAGGGTACAATTTCCCAGG No data
Right 1177268820 21:18819699-18819721 TTCTTAAATATGCAGACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177268815 Original CRISPR CCTGGGAAATTGTACCCTGA TGG (reversed) Intergenic
No off target data available for this crispr