ID: 1177273347

View in Genome Browser
Species Human (GRCh38)
Location 21:18876536-18876558
Sequence CCTGGTTAAGAATCCTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177273341_1177273347 18 Left 1177273341 21:18876495-18876517 CCATATTCTGAATTATATTTCTG No data
Right 1177273347 21:18876536-18876558 CCTGGTTAAGAATCCTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177273347 Original CRISPR CCTGGTTAAGAATCCTCTTT GGG Intergenic