ID: 1177273879 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:18881674-18881696 |
Sequence | CTTTAGTGACAGCAACCAAA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1177273879_1177273880 | 1 | Left | 1177273879 | 21:18881674-18881696 | CCTTTTGGTTGCTGTCACTAAAG | No data | ||
Right | 1177273880 | 21:18881698-18881720 | AAACCATGATTCACATAGATAGG | No data | ||||
1177273879_1177273883 | 14 | Left | 1177273879 | 21:18881674-18881696 | CCTTTTGGTTGCTGTCACTAAAG | No data | ||
Right | 1177273883 | 21:18881711-18881733 | CATAGATAGGATATTGGAAATGG | No data | ||||
1177273879_1177273882 | 8 | Left | 1177273879 | 21:18881674-18881696 | CCTTTTGGTTGCTGTCACTAAAG | No data | ||
Right | 1177273882 | 21:18881705-18881727 | GATTCACATAGATAGGATATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1177273879 | Original CRISPR | CTTTAGTGACAGCAACCAAA AGG (reversed) | Intergenic | ||