ID: 1177273879

View in Genome Browser
Species Human (GRCh38)
Location 21:18881674-18881696
Sequence CTTTAGTGACAGCAACCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177273879_1177273880 1 Left 1177273879 21:18881674-18881696 CCTTTTGGTTGCTGTCACTAAAG No data
Right 1177273880 21:18881698-18881720 AAACCATGATTCACATAGATAGG No data
1177273879_1177273883 14 Left 1177273879 21:18881674-18881696 CCTTTTGGTTGCTGTCACTAAAG No data
Right 1177273883 21:18881711-18881733 CATAGATAGGATATTGGAAATGG No data
1177273879_1177273882 8 Left 1177273879 21:18881674-18881696 CCTTTTGGTTGCTGTCACTAAAG No data
Right 1177273882 21:18881705-18881727 GATTCACATAGATAGGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177273879 Original CRISPR CTTTAGTGACAGCAACCAAA AGG (reversed) Intergenic