ID: 1177273880

View in Genome Browser
Species Human (GRCh38)
Location 21:18881698-18881720
Sequence AAACCATGATTCACATAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177273879_1177273880 1 Left 1177273879 21:18881674-18881696 CCTTTTGGTTGCTGTCACTAAAG No data
Right 1177273880 21:18881698-18881720 AAACCATGATTCACATAGATAGG No data
1177273877_1177273880 20 Left 1177273877 21:18881655-18881677 CCAATCTACTTCATAATCTCCTT No data
Right 1177273880 21:18881698-18881720 AAACCATGATTCACATAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177273880 Original CRISPR AAACCATGATTCACATAGAT AGG Intergenic
No off target data available for this crispr