ID: 1177273882 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:18881705-18881727 |
Sequence | GATTCACATAGATAGGATAT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1177273879_1177273882 | 8 | Left | 1177273879 | 21:18881674-18881696 | CCTTTTGGTTGCTGTCACTAAAG | No data | ||
Right | 1177273882 | 21:18881705-18881727 | GATTCACATAGATAGGATATTGG | No data | ||||
1177273877_1177273882 | 27 | Left | 1177273877 | 21:18881655-18881677 | CCAATCTACTTCATAATCTCCTT | No data | ||
Right | 1177273882 | 21:18881705-18881727 | GATTCACATAGATAGGATATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1177273882 | Original CRISPR | GATTCACATAGATAGGATAT TGG | Intergenic | ||