ID: 1177273882

View in Genome Browser
Species Human (GRCh38)
Location 21:18881705-18881727
Sequence GATTCACATAGATAGGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177273879_1177273882 8 Left 1177273879 21:18881674-18881696 CCTTTTGGTTGCTGTCACTAAAG No data
Right 1177273882 21:18881705-18881727 GATTCACATAGATAGGATATTGG No data
1177273877_1177273882 27 Left 1177273877 21:18881655-18881677 CCAATCTACTTCATAATCTCCTT No data
Right 1177273882 21:18881705-18881727 GATTCACATAGATAGGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177273882 Original CRISPR GATTCACATAGATAGGATAT TGG Intergenic