ID: 1177273883

View in Genome Browser
Species Human (GRCh38)
Location 21:18881711-18881733
Sequence CATAGATAGGATATTGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177273879_1177273883 14 Left 1177273879 21:18881674-18881696 CCTTTTGGTTGCTGTCACTAAAG No data
Right 1177273883 21:18881711-18881733 CATAGATAGGATATTGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177273883 Original CRISPR CATAGATAGGATATTGGAAA TGG Intergenic