ID: 1177274763

View in Genome Browser
Species Human (GRCh38)
Location 21:18895764-18895786
Sequence CTCTGAATCCAGCTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177274763_1177274769 25 Left 1177274763 21:18895764-18895786 CCCTGCTCCAGCTGGATTCAGAG No data
Right 1177274769 21:18895812-18895834 AGAATCATCCAGGCCAGACGTGG No data
1177274763_1177274770 28 Left 1177274763 21:18895764-18895786 CCCTGCTCCAGCTGGATTCAGAG No data
Right 1177274770 21:18895815-18895837 ATCATCCAGGCCAGACGTGGTGG No data
1177274763_1177274766 -6 Left 1177274763 21:18895764-18895786 CCCTGCTCCAGCTGGATTCAGAG No data
Right 1177274766 21:18895781-18895803 TCAGAGAAATCTTGCCAACATGG No data
1177274763_1177274768 15 Left 1177274763 21:18895764-18895786 CCCTGCTCCAGCTGGATTCAGAG No data
Right 1177274768 21:18895802-18895824 GGCTGTGTAAAGAATCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177274763 Original CRISPR CTCTGAATCCAGCTGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr