ID: 1177276023

View in Genome Browser
Species Human (GRCh38)
Location 21:18913791-18913813
Sequence CTCTGGATGAGGAGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177276023_1177276034 17 Left 1177276023 21:18913791-18913813 CCCTCTTCTCTCCTCATCCAGAG No data
Right 1177276034 21:18913831-18913853 GCTGCCAGTTGCACTATGTGGGG No data
1177276023_1177276037 26 Left 1177276023 21:18913791-18913813 CCCTCTTCTCTCCTCATCCAGAG No data
Right 1177276037 21:18913840-18913862 TGCACTATGTGGGGCTGAGAGGG No data
1177276023_1177276033 16 Left 1177276023 21:18913791-18913813 CCCTCTTCTCTCCTCATCCAGAG No data
Right 1177276033 21:18913830-18913852 AGCTGCCAGTTGCACTATGTGGG No data
1177276023_1177276032 15 Left 1177276023 21:18913791-18913813 CCCTCTTCTCTCCTCATCCAGAG No data
Right 1177276032 21:18913829-18913851 GAGCTGCCAGTTGCACTATGTGG No data
1177276023_1177276036 25 Left 1177276023 21:18913791-18913813 CCCTCTTCTCTCCTCATCCAGAG No data
Right 1177276036 21:18913839-18913861 TTGCACTATGTGGGGCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177276023 Original CRISPR CTCTGGATGAGGAGAGAAGA GGG (reversed) Intergenic
No off target data available for this crispr