ID: 1177276032

View in Genome Browser
Species Human (GRCh38)
Location 21:18913829-18913851
Sequence GAGCTGCCAGTTGCACTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177276028_1177276032 4 Left 1177276028 21:18913802-18913824 CCTCATCCAGAGGGAAGGAGTCT No data
Right 1177276032 21:18913829-18913851 GAGCTGCCAGTTGCACTATGTGG No data
1177276029_1177276032 -2 Left 1177276029 21:18913808-18913830 CCAGAGGGAAGGAGTCTCCCAGA No data
Right 1177276032 21:18913829-18913851 GAGCTGCCAGTTGCACTATGTGG No data
1177276023_1177276032 15 Left 1177276023 21:18913791-18913813 CCCTCTTCTCTCCTCATCCAGAG No data
Right 1177276032 21:18913829-18913851 GAGCTGCCAGTTGCACTATGTGG No data
1177276024_1177276032 14 Left 1177276024 21:18913792-18913814 CCTCTTCTCTCCTCATCCAGAGG No data
Right 1177276032 21:18913829-18913851 GAGCTGCCAGTTGCACTATGTGG No data
1177276022_1177276032 16 Left 1177276022 21:18913790-18913812 CCCCTCTTCTCTCCTCATCCAGA No data
Right 1177276032 21:18913829-18913851 GAGCTGCCAGTTGCACTATGTGG No data
1177276021_1177276032 28 Left 1177276021 21:18913778-18913800 CCTCTTTATTGTCCCCTCTTCTC No data
Right 1177276032 21:18913829-18913851 GAGCTGCCAGTTGCACTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177276032 Original CRISPR GAGCTGCCAGTTGCACTATG TGG Intergenic
No off target data available for this crispr