ID: 1177276036

View in Genome Browser
Species Human (GRCh38)
Location 21:18913839-18913861
Sequence TTGCACTATGTGGGGCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177276024_1177276036 24 Left 1177276024 21:18913792-18913814 CCTCTTCTCTCCTCATCCAGAGG No data
Right 1177276036 21:18913839-18913861 TTGCACTATGTGGGGCTGAGAGG No data
1177276023_1177276036 25 Left 1177276023 21:18913791-18913813 CCCTCTTCTCTCCTCATCCAGAG No data
Right 1177276036 21:18913839-18913861 TTGCACTATGTGGGGCTGAGAGG No data
1177276022_1177276036 26 Left 1177276022 21:18913790-18913812 CCCCTCTTCTCTCCTCATCCAGA No data
Right 1177276036 21:18913839-18913861 TTGCACTATGTGGGGCTGAGAGG No data
1177276029_1177276036 8 Left 1177276029 21:18913808-18913830 CCAGAGGGAAGGAGTCTCCCAGA No data
Right 1177276036 21:18913839-18913861 TTGCACTATGTGGGGCTGAGAGG No data
1177276031_1177276036 -10 Left 1177276031 21:18913826-18913848 CCAGAGCTGCCAGTTGCACTATG No data
Right 1177276036 21:18913839-18913861 TTGCACTATGTGGGGCTGAGAGG No data
1177276030_1177276036 -9 Left 1177276030 21:18913825-18913847 CCCAGAGCTGCCAGTTGCACTAT No data
Right 1177276036 21:18913839-18913861 TTGCACTATGTGGGGCTGAGAGG No data
1177276028_1177276036 14 Left 1177276028 21:18913802-18913824 CCTCATCCAGAGGGAAGGAGTCT No data
Right 1177276036 21:18913839-18913861 TTGCACTATGTGGGGCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177276036 Original CRISPR TTGCACTATGTGGGGCTGAG AGG Intergenic
No off target data available for this crispr