ID: 1177278173

View in Genome Browser
Species Human (GRCh38)
Location 21:18943166-18943188
Sequence CAGTAAGACAAGGGGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177278168_1177278173 29 Left 1177278168 21:18943114-18943136 CCTGGAAATTGCTACAGTTTTGT No data
Right 1177278173 21:18943166-18943188 CAGTAAGACAAGGGGCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177278173 Original CRISPR CAGTAAGACAAGGGGCCCTG AGG Intergenic
No off target data available for this crispr