ID: 1177278585

View in Genome Browser
Species Human (GRCh38)
Location 21:18948914-18948936
Sequence CCTTCCAATGATCTGTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177278581_1177278585 6 Left 1177278581 21:18948885-18948907 CCTGATCCCTACATCGAACTATA No data
Right 1177278585 21:18948914-18948936 CCTTCCAATGATCTGTTTTGTGG No data
1177278580_1177278585 22 Left 1177278580 21:18948869-18948891 CCTGTGCTGCTTCTATCCTGATC No data
Right 1177278585 21:18948914-18948936 CCTTCCAATGATCTGTTTTGTGG No data
1177278583_1177278585 -1 Left 1177278583 21:18948892-18948914 CCTACATCGAACTATACACAGAC No data
Right 1177278585 21:18948914-18948936 CCTTCCAATGATCTGTTTTGTGG No data
1177278582_1177278585 0 Left 1177278582 21:18948891-18948913 CCCTACATCGAACTATACACAGA No data
Right 1177278585 21:18948914-18948936 CCTTCCAATGATCTGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177278585 Original CRISPR CCTTCCAATGATCTGTTTTG TGG Intergenic
No off target data available for this crispr