ID: 1177279230

View in Genome Browser
Species Human (GRCh38)
Location 21:18957941-18957963
Sequence TTTTTTTTTTTCTGTGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177279230_1177279236 28 Left 1177279230 21:18957941-18957963 CCACACACACAGAAAAAAAAAAA No data
Right 1177279236 21:18957992-18958014 AGCAAAAAGAGGAAAGCTGGAGG No data
1177279230_1177279235 25 Left 1177279230 21:18957941-18957963 CCACACACACAGAAAAAAAAAAA No data
Right 1177279235 21:18957989-18958011 CTGAGCAAAAAGAGGAAAGCTGG No data
1177279230_1177279233 17 Left 1177279230 21:18957941-18957963 CCACACACACAGAAAAAAAAAAA No data
Right 1177279233 21:18957981-18958003 TAACAATCCTGAGCAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177279230 Original CRISPR TTTTTTTTTTTCTGTGTGTG TGG (reversed) Intergenic
No off target data available for this crispr