ID: 1177279233

View in Genome Browser
Species Human (GRCh38)
Location 21:18957981-18958003
Sequence TAACAATCCTGAGCAAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177279231_1177279233 -10 Left 1177279231 21:18957968-18957990 CCAAAGAGCCAAATAACAATCCT No data
Right 1177279233 21:18957981-18958003 TAACAATCCTGAGCAAAAAGAGG No data
1177279230_1177279233 17 Left 1177279230 21:18957941-18957963 CCACACACACAGAAAAAAAAAAA No data
Right 1177279233 21:18957981-18958003 TAACAATCCTGAGCAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177279233 Original CRISPR TAACAATCCTGAGCAAAAAG AGG Intergenic
No off target data available for this crispr