ID: 1177282197

View in Genome Browser
Species Human (GRCh38)
Location 21:18995061-18995083
Sequence CTTTCTATGCAGCAAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177282197_1177282201 15 Left 1177282197 21:18995061-18995083 CCTGCCACTTGCTGCATAGAAAG No data
Right 1177282201 21:18995099-18995121 AAAATCACTGCCAAGGAAGAAGG No data
1177282197_1177282200 8 Left 1177282197 21:18995061-18995083 CCTGCCACTTGCTGCATAGAAAG No data
Right 1177282200 21:18995092-18995114 TGAGACAAAAATCACTGCCAAGG No data
1177282197_1177282205 26 Left 1177282197 21:18995061-18995083 CCTGCCACTTGCTGCATAGAAAG No data
Right 1177282205 21:18995110-18995132 CAAGGAAGAAGGCTTTAACGGGG No data
1177282197_1177282204 25 Left 1177282197 21:18995061-18995083 CCTGCCACTTGCTGCATAGAAAG No data
Right 1177282204 21:18995109-18995131 CCAAGGAAGAAGGCTTTAACGGG 0: 3
1: 93
2: 147
3: 144
4: 233
1177282197_1177282202 24 Left 1177282197 21:18995061-18995083 CCTGCCACTTGCTGCATAGAAAG No data
Right 1177282202 21:18995108-18995130 GCCAAGGAAGAAGGCTTTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177282197 Original CRISPR CTTTCTATGCAGCAAGTGGC AGG (reversed) Intergenic
No off target data available for this crispr