ID: 1177282408

View in Genome Browser
Species Human (GRCh38)
Location 21:18998864-18998886
Sequence GAGACCAGGAGTAAACCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177282405_1177282408 12 Left 1177282405 21:18998829-18998851 CCACTACTCAGGAAGCTAATATG No data
Right 1177282408 21:18998864-18998886 GAGACCAGGAGTAAACCAGCTGG No data
1177282403_1177282408 14 Left 1177282403 21:18998827-18998849 CCCCACTACTCAGGAAGCTAATA No data
Right 1177282408 21:18998864-18998886 GAGACCAGGAGTAAACCAGCTGG No data
1177282402_1177282408 22 Left 1177282402 21:18998819-18998841 CCTGTAATCCCCACTACTCAGGA 0: 61
1: 1875
2: 59766
3: 149090
4: 234408
Right 1177282408 21:18998864-18998886 GAGACCAGGAGTAAACCAGCTGG No data
1177282404_1177282408 13 Left 1177282404 21:18998828-18998850 CCCACTACTCAGGAAGCTAATAT No data
Right 1177282408 21:18998864-18998886 GAGACCAGGAGTAAACCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177282408 Original CRISPR GAGACCAGGAGTAAACCAGC TGG Intergenic
No off target data available for this crispr