ID: 1177289047

View in Genome Browser
Species Human (GRCh38)
Location 21:19086430-19086452
Sequence ACAAGGACACTTGTGATTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177289047_1177289052 -5 Left 1177289047 21:19086430-19086452 CCCTAAATCACAAGTGTCCTTGT No data
Right 1177289052 21:19086448-19086470 CTTGTAGGAGAGAGGCTGAATGG No data
1177289047_1177289054 16 Left 1177289047 21:19086430-19086452 CCCTAAATCACAAGTGTCCTTGT No data
Right 1177289054 21:19086469-19086491 GGATATTTTTCTACAGAAGAGGG No data
1177289047_1177289055 19 Left 1177289047 21:19086430-19086452 CCCTAAATCACAAGTGTCCTTGT No data
Right 1177289055 21:19086472-19086494 TATTTTTCTACAGAAGAGGGAGG No data
1177289047_1177289053 15 Left 1177289047 21:19086430-19086452 CCCTAAATCACAAGTGTCCTTGT No data
Right 1177289053 21:19086468-19086490 TGGATATTTTTCTACAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177289047 Original CRISPR ACAAGGACACTTGTGATTTA GGG (reversed) Intergenic
No off target data available for this crispr