ID: 1177295142

View in Genome Browser
Species Human (GRCh38)
Location 21:19163561-19163583
Sequence GAGAAAGAGTGCAGTGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177295142_1177295150 25 Left 1177295142 21:19163561-19163583 CCACAATCACTGCACTCTTTCTC No data
Right 1177295150 21:19163609-19163631 TGTCGTATGGCTATTGCCAGGGG No data
1177295142_1177295148 23 Left 1177295142 21:19163561-19163583 CCACAATCACTGCACTCTTTCTC No data
Right 1177295148 21:19163607-19163629 TGTGTCGTATGGCTATTGCCAGG No data
1177295142_1177295146 12 Left 1177295142 21:19163561-19163583 CCACAATCACTGCACTCTTTCTC No data
Right 1177295146 21:19163596-19163618 GATTCTCTGCCTGTGTCGTATGG No data
1177295142_1177295149 24 Left 1177295142 21:19163561-19163583 CCACAATCACTGCACTCTTTCTC No data
Right 1177295149 21:19163608-19163630 GTGTCGTATGGCTATTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177295142 Original CRISPR GAGAAAGAGTGCAGTGATTG TGG (reversed) Intergenic
No off target data available for this crispr